Incidental Mutation 'R6289:Arid3c'
ID508294
Institutional Source Beutler Lab
Gene Symbol Arid3c
Ensembl Gene ENSMUSG00000066224
Gene NameAT rich interactive domain 3C (BRIGHT-like)
SynonymsOTTMUSG00000006683
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41723836-41731142 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 41724285 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030158] [ENSMUST00000084698] [ENSMUST00000108041] [ENSMUST00000150809] [ENSMUST00000171251] [ENSMUST00000171641]
Predicted Effect probably benign
Transcript: ENSMUST00000030158
SMART Domains Protein: ENSMUSP00000030158
Gene: ENSMUSG00000028447

DomainStartEndE-ValueType
Pfam:Dynactin_p22 6 170 2.8e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000084698
AA Change: T393I
SMART Domains Protein: ENSMUSP00000081748
Gene: ENSMUSG00000066224
AA Change: T393I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147120
Predicted Effect unknown
Transcript: ENSMUST00000150809
AA Change: T363I
SMART Domains Protein: ENSMUSP00000116411
Gene: ENSMUSG00000066224
AA Change: T363I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 357 379 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000171251
AA Change: T393I
SMART Domains Protein: ENSMUSP00000127678
Gene: ENSMUSG00000066224
AA Change: T393I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171641
SMART Domains Protein: ENSMUSP00000130988
Gene: ENSMUSG00000028447

DomainStartEndE-ValueType
Pfam:Dynactin_p22 1 149 1.4e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene is a member of the ARID (AT-rich interaction domain) family of proteins. The ARID domain is a helix-turn-helix motif-based DNA-binding domain. ARID family members have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Arid3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02297:Arid3c APN 4 41730021 missense possibly damaging 0.72
R0445:Arid3c UTSW 4 41725172 missense probably benign 0.00
R0675:Arid3c UTSW 4 41725958 missense probably damaging 1.00
R1617:Arid3c UTSW 4 41725103 missense probably damaging 1.00
R1711:Arid3c UTSW 4 41725947 missense probably damaging 0.99
R1929:Arid3c UTSW 4 41724744 missense probably damaging 1.00
R2270:Arid3c UTSW 4 41724744 missense probably damaging 1.00
R2271:Arid3c UTSW 4 41724744 missense probably damaging 1.00
R2272:Arid3c UTSW 4 41724744 missense probably damaging 1.00
R2867:Arid3c UTSW 4 41725958 missense probably damaging 1.00
R2867:Arid3c UTSW 4 41725958 missense probably damaging 1.00
R4818:Arid3c UTSW 4 41730072 missense possibly damaging 0.72
R5622:Arid3c UTSW 4 41729959 missense probably benign 0.02
R6995:Arid3c UTSW 4 41725087 missense probably damaging 1.00
R7339:Arid3c UTSW 4 41729883 critical splice donor site probably null
R8244:Arid3c UTSW 4 41729997 missense possibly damaging 0.61
Z1177:Arid3c UTSW 4 41730177 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGCATGCTGACATCAACC -3'
(R):5'- CATGGGATGTCTGCTTTGTCAC -3'

Sequencing Primer
(F):5'- TGCTGACATCAACCAGGACTG -3'
(R):5'- GTGAGTATTTATTGCGCACCTAC -3'
Posted On2018-03-15