Incidental Mutation 'R6289:Grip2'
ID508298
Institutional Source Beutler Lab
Gene Symbol Grip2
Ensembl Gene ENSMUSG00000030098
Gene Nameglutamate receptor interacting protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6289 (G1)
Quality Score224.009
Status Validated
Chromosome6
Chromosomal Location91761509-91827250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91778871 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 586 (I586T)
Ref Sequence ENSEMBL: ENSMUSP00000124709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159684] [ENSMUST00000161566] [ENSMUST00000162293] [ENSMUST00000162300]
Predicted Effect probably benign
Transcript: ENSMUST00000159684
AA Change: I545T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125047
Gene: ENSMUSG00000030098
AA Change: I545T

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 385 390 N/A INTRINSIC
PDZ 426 506 2.18e-15 SMART
PDZ 527 602 3.86e-16 SMART
PDZ 625 699 1.38e-17 SMART
low complexity region 778 793 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
PDZ 910 982 2.95e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161566
SMART Domains Protein: ENSMUSP00000123941
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 9.96e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162293
AA Change: I534T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124717
Gene: ENSMUSG00000030098
AA Change: I534T

DomainStartEndE-ValueType
PDZ 10 84 1.12e-12 SMART
PDZ 109 187 3.8e-15 SMART
PDZ 210 285 7.9e-13 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 374 379 N/A INTRINSIC
PDZ 415 495 2.18e-15 SMART
PDZ 516 591 3.86e-16 SMART
PDZ 614 688 1.38e-17 SMART
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162300
AA Change: I586T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124709
Gene: ENSMUSG00000030098
AA Change: I586T

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 388 400 N/A INTRINSIC
low complexity region 426 431 N/A INTRINSIC
PDZ 467 547 2.18e-15 SMART
PDZ 568 643 3.86e-16 SMART
PDZ 666 740 1.38e-17 SMART
low complexity region 819 834 N/A INTRINSIC
low complexity region 908 919 N/A INTRINSIC
PDZ 951 1023 2.95e-12 SMART
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous null mice are born in numbers expected by the Mendelian ratio and show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Grip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Grip2 APN 6 91782897 missense probably benign 0.00
IGL01748:Grip2 APN 6 91764743 missense probably damaging 1.00
IGL01838:Grip2 APN 6 91764763 missense possibly damaging 0.92
IGL02392:Grip2 APN 6 91787295 missense probably damaging 1.00
IGL02620:Grip2 APN 6 91778606 missense possibly damaging 0.93
IGL02862:Grip2 APN 6 91788104 missense probably damaging 0.98
IGL03027:Grip2 APN 6 91778871 missense probably benign 0.02
IGL03180:Grip2 APN 6 91785761 splice site probably benign
R0265:Grip2 UTSW 6 91773792 critical splice donor site probably null
R0448:Grip2 UTSW 6 91779213 missense probably damaging 1.00
R0597:Grip2 UTSW 6 91796197 intron probably benign
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1664:Grip2 UTSW 6 91765252 missense probably damaging 1.00
R1703:Grip2 UTSW 6 91777398 missense probably damaging 1.00
R1793:Grip2 UTSW 6 91783642 missense probably benign 0.03
R1951:Grip2 UTSW 6 91783848 missense probably damaging 1.00
R2001:Grip2 UTSW 6 91779850 missense probably benign 0.00
R4730:Grip2 UTSW 6 91785712 makesense probably null
R4754:Grip2 UTSW 6 91779182 missense probably damaging 1.00
R4754:Grip2 UTSW 6 91779192 missense probably damaging 0.97
R4773:Grip2 UTSW 6 91782432 missense possibly damaging 0.80
R5135:Grip2 UTSW 6 91773916 missense possibly damaging 0.89
R5213:Grip2 UTSW 6 91779831 missense probably benign 0.04
R5972:Grip2 UTSW 6 91807281 missense probably benign 0.01
R6176:Grip2 UTSW 6 91779851 missense probably benign 0.00
R6188:Grip2 UTSW 6 91763533 missense probably damaging 1.00
R6345:Grip2 UTSW 6 91765388 missense possibly damaging 0.91
R6348:Grip2 UTSW 6 91780438 missense probably damaging 0.99
R6394:Grip2 UTSW 6 91787201 missense probably damaging 1.00
R6658:Grip2 UTSW 6 91786491 missense probably damaging 1.00
R7065:Grip2 UTSW 6 91783569 critical splice donor site probably null
R7074:Grip2 UTSW 6 91784708 missense probably benign 0.24
R7308:Grip2 UTSW 6 91778688 missense possibly damaging 0.74
R7607:Grip2 UTSW 6 91788412 missense probably benign
R7617:Grip2 UTSW 6 91765050 splice site probably null
R7970:Grip2 UTSW 6 91786532 missense probably benign 0.07
R8221:Grip2 UTSW 6 91785684 missense possibly damaging 0.90
R8549:Grip2 UTSW 6 91773788 splice site probably null
R8962:Grip2 UTSW 6 91777410 missense probably damaging 1.00
RF003:Grip2 UTSW 6 91783593 missense probably benign 0.02
Z1176:Grip2 UTSW 6 91763510 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATATTGTCAATGGCCAGCAGC -3'
(R):5'- CCATTAGCTGTAAGTCCCCTTG -3'

Sequencing Primer
(F):5'- TCAATGGCCAGCAGCTTGTC -3'
(R):5'- TCTCCACAATGGGATGCAG -3'
Posted On2018-03-15