Incidental Mutation 'R6289:C1s1'
ID508299
Institutional Source Beutler Lab
Gene Symbol C1s1
Ensembl Gene ENSMUSG00000038521
Gene Namecomplement component 1, s subcomponent 1
SynonymsC1s
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124530345-124542359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124531176 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 618 (F618S)
Ref Sequence ENSEMBL: ENSMUSP00000125712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160505] [ENSMUST00000162443]
Predicted Effect probably damaging
Transcript: ENSMUST00000160505
AA Change: F618S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125531
Gene: ENSMUSG00000038521
AA Change: F618S

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160967
Predicted Effect probably damaging
Transcript: ENSMUST00000162443
AA Change: F618S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125712
Gene: ENSMUSG00000038521
AA Change: F618S

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Meta Mutation Damage Score 0.5569 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in C1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:C1s1 APN 6 124541334 missense probably benign 0.02
IGL02590:C1s1 APN 6 124531276 missense possibly damaging 0.89
IGL02968:C1s1 APN 6 124540351 missense probably damaging 0.99
IGL03301:C1s1 APN 6 124541324 splice site probably benign
BB008:C1s1 UTSW 6 124533400 missense probably damaging 1.00
BB018:C1s1 UTSW 6 124533400 missense probably damaging 1.00
R0105:C1s1 UTSW 6 124541318 splice site probably benign
R0396:C1s1 UTSW 6 124533354 missense probably benign 0.03
R0759:C1s1 UTSW 6 124531437 missense probably damaging 1.00
R1145:C1s1 UTSW 6 124540800 missense probably damaging 1.00
R1145:C1s1 UTSW 6 124540800 missense probably damaging 1.00
R1396:C1s1 UTSW 6 124531051 missense probably damaging 1.00
R1466:C1s1 UTSW 6 124531131 missense probably damaging 1.00
R1466:C1s1 UTSW 6 124531131 missense probably damaging 1.00
R1627:C1s1 UTSW 6 124537480 missense probably damaging 1.00
R1855:C1s1 UTSW 6 124534356 critical splice donor site probably null
R2010:C1s1 UTSW 6 124537394 missense probably damaging 1.00
R2349:C1s1 UTSW 6 124541473 start gained probably benign
R4544:C1s1 UTSW 6 124531540 missense probably benign 0.31
R4661:C1s1 UTSW 6 124536490 missense probably benign 0.22
R5383:C1s1 UTSW 6 124534401 missense probably damaging 1.00
R5687:C1s1 UTSW 6 124540950 missense probably benign 0.01
R5846:C1s1 UTSW 6 124540953 missense possibly damaging 0.93
R6410:C1s1 UTSW 6 124531158 missense probably damaging 1.00
R6983:C1s1 UTSW 6 124540896 missense possibly damaging 0.93
R7931:C1s1 UTSW 6 124533400 missense probably damaging 1.00
R8141:C1s1 UTSW 6 124531362 missense probably damaging 1.00
R8341:C1s1 UTSW 6 124531156 missense probably damaging 1.00
R8399:C1s1 UTSW 6 124535293 missense probably benign 0.00
RF029:C1s1 UTSW 6 124541351 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TACCTTTGTGTAGACCCCATAAG -3'
(R):5'- TGCAGCTGAAAGACCCTGTG -3'

Sequencing Primer
(F):5'- TTGTGTAGACCCCATAAGTCCCAC -3'
(R):5'- GACCCTGTGAAAATGGGACCC -3'
Posted On2018-03-15