Mutagenetix > Incidental Mutation

Incidental Mutation 'R6289:Tubgcp5'

508301

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp5

Ensembl Gene

ENSMUSG00000033790

Gene Name

tubulin, gamma complex associated protein 5

Synonyms

B130010C12Rik, GCP5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R6289 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55794154-55831677 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55795923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 58 (S58G)

Ref Sequence

ENSEMBL: ENSMUSP00000146033 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191] [ENSMUST00000206454]

AlphaFold

Q8BKN5

Predicted Effect

probably benign
Transcript: ENSMUST00000032627
AA Change: S58G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: S58G

Domain	Start	End	E-Value	Type
low complexity region	109	124	N/A	INTRINSIC
Pfam:Spc97_Spc98	273	942	1.2e-126	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205796
AA Change: S58G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000206191
AA Change: S58G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000206454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206789

Meta Mutation Damage Score

0.0625

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	A	G	12: 81,560,706	V94A	probably damaging	Het
Ankrd36	T	C	11: 5,628,837	S34P	probably damaging	Het
Arid3c	G	A	4: 41,724,285		probably benign	Het
Atg16l1	C	T	1: 87,756,215	R6C	probably damaging	Het
Bex6	A	G	16: 32,186,712	I113V	probably benign	Het
Blk	T	C	14: 63,375,892		probably null	Het
C1s1	A	G	6: 124,531,176	F618S	probably damaging	Het
Casp8ap2	C	T	4: 32,639,590	H215Y	probably damaging	Het
Casp9	T	A	4: 141,807,185	V302E	probably damaging	Het
Ccl2	A	C	11: 82,036,969	K80Q	probably benign	Het
Cit	T	G	5: 116,006,326	*2014E	probably null	Het
Dclk2	A	T	3: 86,831,817	S292T	probably benign	Het
Ddx23	T	C	15: 98,649,884	E463G	probably benign	Het
Dennd1b	T	C	1: 139,168,945		probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fgf10	C	A	13: 118,715,492	Q37K	probably benign	Het
Fgf22	A	G	10: 79,755,207	D24G	probably damaging	Het
Gabra1	A	G	11: 42,155,019	I88T	probably damaging	Het
Grip2	A	G	6: 91,778,871	I586T	probably benign	Het
Hist1h1b	G	T	13: 21,780,439	P39Q	probably damaging	Het
Hpse2	T	A	19: 42,788,979	N583Y	probably null	Het
Katnal2	A	G	18: 77,017,455		probably null	Het
Keg1	T	G	19: 12,714,573	C85G	probably damaging	Het
Kidins220	T	A	12: 25,056,616	L1356H	probably damaging	Het
Lifr	A	G	15: 7,166,910	K192E	probably benign	Het
Mks1	T	C	11: 87,859,659		probably null	Het
Olfr1464-ps1	T	C	19: 13,282,794	K88R	possibly damaging	Het
Rars	C	T	11: 35,826,067	M207I	probably damaging	Het
Rbm6	T	C	9: 107,777,948	Y896C	probably damaging	Het
Scarf1	T	A	11: 75,525,416	W472R	possibly damaging	Het
Sept8	A	G	11: 53,534,478	N66S	probably damaging	Het
Smcr8	T	C	11: 60,778,598	F191L	probably damaging	Het
Tdrd6	A	G	17: 43,624,520	M1879T	probably benign	Het
Tlr3	C	T	8: 45,396,929	R901Q	probably benign	Het
Trpc4ap	T	C	2: 155,663,707	T203A	possibly damaging	Het
Ubtd2	A	G	11: 32,516,177	E132G	probably damaging	Het
Uggt2	T	A	14: 119,041,602	E831V	probably damaging	Het
Umodl1	A	G	17: 30,982,351	N418S	probably benign	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Wdhd1	A	C	14: 47,258,496	I637S	possibly damaging	Het

Other mutations in Tubgcp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Tubgcp5	APN	7	55806595	missense	possibly damaging	0.91
IGL01291:Tubgcp5	APN	7	55808529	missense	possibly damaging	0.83
IGL01343:Tubgcp5	APN	7	55796031	splice site	probably benign
IGL01597:Tubgcp5	APN	7	55806832	splice site	probably benign
IGL01688:Tubgcp5	APN	7	55815018	missense	possibly damaging	0.92
IGL01843:Tubgcp5	APN	7	55799473	missense	probably benign	0.02
IGL01950:Tubgcp5	APN	7	55806088	missense	possibly damaging	0.93
IGL01957:Tubgcp5	APN	7	55818757	missense	probably damaging	1.00
IGL02902:Tubgcp5	APN	7	55806607	nonsense	probably null
IGL03105:Tubgcp5	APN	7	55825581	missense	probably damaging	1.00
ANU05:Tubgcp5	UTSW	7	55808529	missense	possibly damaging	0.83
R0078:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R0322:Tubgcp5	UTSW	7	55814978	missense	probably damaging	0.98
R0362:Tubgcp5	UTSW	7	55800684	missense	probably damaging	1.00
R0449:Tubgcp5	UTSW	7	55823567	missense	probably benign
R0488:Tubgcp5	UTSW	7	55829338	missense	probably damaging	0.96
R0853:Tubgcp5	UTSW	7	55814851	splice site	probably benign
R0885:Tubgcp5	UTSW	7	55806055	nonsense	probably null
R1483:Tubgcp5	UTSW	7	55825707	critical splice donor site	probably null
R1746:Tubgcp5	UTSW	7	55808537	missense	probably benign	0.05
R1766:Tubgcp5	UTSW	7	55815020	missense	probably benign	0.15
R2148:Tubgcp5	UTSW	7	55799511	missense	probably damaging	1.00
R2229:Tubgcp5	UTSW	7	55830881	missense	probably damaging	1.00
R3766:Tubgcp5	UTSW	7	55830866	missense	probably damaging	0.98
R4154:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R4838:Tubgcp5	UTSW	7	55794185	unclassified	probably benign
R4948:Tubgcp5	UTSW	7	55806123	missense	probably benign	0.00
R5110:Tubgcp5	UTSW	7	55808637	missense	probably damaging	0.96
R5347:Tubgcp5	UTSW	7	55823685	missense	probably damaging	1.00
R5417:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R5574:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R5758:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R5957:Tubgcp5	UTSW	7	55814962	missense	probably benign	0.03
R6014:Tubgcp5	UTSW	7	55823609	missense	probably benign
R6141:Tubgcp5	UTSW	7	55806778	missense	probably benign	0.30
R6511:Tubgcp5	UTSW	7	55817392	nonsense	probably null
R6563:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R6574:Tubgcp5	UTSW	7	55823583	missense	probably benign
R6596:Tubgcp5	UTSW	7	55806634	missense	probably benign	0.38
R7016:Tubgcp5	UTSW	7	55794229	missense	possibly damaging	0.76
R7038:Tubgcp5	UTSW	7	55805366	missense	probably damaging	0.99
R7075:Tubgcp5	UTSW	7	55829407	missense	probably benign	0.04
R7083:Tubgcp5	UTSW	7	55800695	nonsense	probably null
R7213:Tubgcp5	UTSW	7	55806112	missense	probably damaging	0.97
R7284:Tubgcp5	UTSW	7	55823567	missense	probably benign
R7600:Tubgcp5	UTSW	7	55808513	missense	probably benign
R7813:Tubgcp5	UTSW	7	55800696	missense	possibly damaging	0.49
R7920:Tubgcp5	UTSW	7	55816562	missense	probably benign	0.00
R7948:Tubgcp5	UTSW	7	55794248	missense	probably benign	0.01
R8438:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R8499:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R9087:Tubgcp5	UTSW	7	55817358	missense	probably damaging	1.00
R9211:Tubgcp5	UTSW	7	55806583	missense	probably benign	0.05
R9269:Tubgcp5	UTSW	7	55795945	missense	possibly damaging	0.94
R9329:Tubgcp5	UTSW	7	55829433	critical splice donor site	probably null
R9355:Tubgcp5	UTSW	7	55817429	critical splice donor site	probably null
R9498:Tubgcp5	UTSW	7	55813485	missense	possibly damaging	0.46
R9687:Tubgcp5	UTSW	7	55825579	critical splice acceptor site	probably null
Z1088:Tubgcp5	UTSW	7	55815101	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTATACTGAACATAACTGTGGGAC -3'
(R):5'- TCTGTGCTGGGAAGAGATGC -3'

Sequencing Primer
(F):5'- CTGTGGGACATATAAAAAGACAAAGG -3'
(R):5'- GAGAACGCATCAATGAATAC -3'

Posted On

2018-03-15