Incidental Mutation 'R6289:Gabra1'
ID508307
Institutional Source Beutler Lab
Gene Symbol Gabra1
Ensembl Gene ENSMUSG00000010803
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 1
SynonymsGabra-1, GABAAR alpha1, GABAA alpha 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location42130939-42182930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42155019 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 88 (I88T)
Ref Sequence ENSEMBL: ENSMUSP00000147186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020707] [ENSMUST00000153147] [ENSMUST00000205546] [ENSMUST00000206105] [ENSMUST00000207274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020707
AA Change: I88T

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020707
Gene: ENSMUSG00000010803
AA Change: I88T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 41 249 1.5e-52 PFAM
Pfam:Neur_chan_memb 256 347 8.6e-33 PFAM
low complexity region 395 411 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153147
AA Change: I88T

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129056
Gene: ENSMUSG00000010803
AA Change: I88T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 46 84 2e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205546
AA Change: I88T

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000206105
AA Change: I88T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000207274
AA Change: I88T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.1882 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knockout alleles or ones with various nucleotide substitutions exhibit altered life span, abnormal response to benzodiazepines and imidazopyridines, abnormal behaviors and abnormal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Gabra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Gabra1 APN 11 42133626 missense probably benign 0.06
IGL01645:Gabra1 APN 11 42135562 missense probably damaging 1.00
IGL01893:Gabra1 APN 11 42133759 missense possibly damaging 0.80
IGL02114:Gabra1 APN 11 42135575 missense probably damaging 1.00
IGL02378:Gabra1 APN 11 42140255 missense probably damaging 1.00
IGL03402:Gabra1 APN 11 42133518 missense probably damaging 0.96
opulence UTSW 11 42162555 missense probably benign 0.08
Splendor UTSW 11 42135443 missense possibly damaging 0.94
R0546:Gabra1 UTSW 11 42162601 missense probably damaging 0.96
R1495:Gabra1 UTSW 11 42154944 missense probably damaging 1.00
R1538:Gabra1 UTSW 11 42140350 missense probably benign 0.19
R1850:Gabra1 UTSW 11 42179576 missense probably benign
R1989:Gabra1 UTSW 11 42155015 missense probably damaging 1.00
R2061:Gabra1 UTSW 11 42133798 unclassified probably benign
R3758:Gabra1 UTSW 11 42175936 missense probably benign 0.25
R4781:Gabra1 UTSW 11 42133661 missense probably damaging 0.98
R4788:Gabra1 UTSW 11 42147153 missense probably damaging 1.00
R5215:Gabra1 UTSW 11 42154828 missense probably damaging 1.00
R5306:Gabra1 UTSW 11 42133552 missense probably benign 0.00
R5655:Gabra1 UTSW 11 42182923 splice site probably null
R5789:Gabra1 UTSW 11 42182915 unclassified probably benign
R6273:Gabra1 UTSW 11 42140311 missense probably damaging 0.99
R6298:Gabra1 UTSW 11 42182378 unclassified probably benign
R6475:Gabra1 UTSW 11 42162555 missense probably benign 0.08
R6552:Gabra1 UTSW 11 42147099 missense probably damaging 0.99
R7338:Gabra1 UTSW 11 42182294 missense unknown
R7405:Gabra1 UTSW 11 42155023 missense probably damaging 1.00
R7515:Gabra1 UTSW 11 42154833 missense possibly damaging 0.95
R7725:Gabra1 UTSW 11 42135443 missense possibly damaging 0.94
R7727:Gabra1 UTSW 11 42133591 missense probably damaging 1.00
R8193:Gabra1 UTSW 11 42147141 missense probably damaging 1.00
R8319:Gabra1 UTSW 11 42135488 missense probably damaging 1.00
R8362:Gabra1 UTSW 11 42176004 missense probably benign 0.15
R8890:Gabra1 UTSW 11 42133726 missense probably benign 0.00
R8905:Gabra1 UTSW 11 42147225 missense possibly damaging 0.95
R8918:Gabra1 UTSW 11 42135493 missense probably damaging 1.00
X0066:Gabra1 UTSW 11 42133738 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAACCATGGCTGTCCTTACCTC -3'
(R):5'- AAGCCATCATTTATTCCTCTAACAC -3'

Sequencing Primer
(F):5'- AGAGTGCCATCCTCTGTGATACG -3'
(R):5'- TCCTCTAACACTAAACATCTAAGTGC -3'
Posted On2018-03-15