Incidental Mutation 'R6289:Ccl2'
ID508311
Institutional Source Beutler Lab
Gene Symbol Ccl2
Ensembl Gene ENSMUSG00000035385
Gene Namechemokine (C-C motif) ligand 2
SynonymsSigje, SMC-CF, monocyte chemoattractant protein-1, MCP1, MCP-1, monocyte chemotactic protein, Scya2, HC11, MCAF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82035571-82037453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 82036969 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 80 (K80Q)
Ref Sequence ENSEMBL: ENSMUSP00000000193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000193] [ENSMUST00000171515]
Predicted Effect probably benign
Transcript: ENSMUST00000000193
AA Change: K80Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000000193
Gene: ENSMUSG00000035385
AA Change: K80Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 31 90 4.63e-32 SMART
low complexity region 128 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124479
Predicted Effect probably benign
Transcript: ENSMUST00000171515
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene is one of several cytokine genes clustered on chromosome 11. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and memory T cells but not for neutrophils. The human ortholog has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, such as psoriasis, rheumatoid arthritis, and atherosclerosis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective macrophage recruitment, abnormal choroid morphology, photoreceptor degeneration, and altered response to injury, infection, alcohol, and a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Ccl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Ccl2 APN 11 82035732 missense possibly damaging 0.83
IGL01807:Ccl2 APN 11 82035687 missense possibly damaging 0.88
R2227:Ccl2 UTSW 11 82036601 critical splice donor site probably null
R3772:Ccl2 UTSW 11 82036958 missense probably damaging 1.00
R4027:Ccl2 UTSW 11 82037059 missense probably benign 0.23
R5049:Ccl2 UTSW 11 82036507 missense probably damaging 0.99
R5073:Ccl2 UTSW 11 82037158 intron probably benign
R7041:Ccl2 UTSW 11 82035663 start codon destroyed probably null 1.00
R8392:Ccl2 UTSW 11 82036982 missense probably damaging 0.98
R8783:Ccl2 UTSW 11 82036534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCTTTCTACTCCACAAG -3'
(R):5'- ACACTGGTCACTCCTACAGAAG -3'

Sequencing Primer
(F):5'- GCTTATCTTAGAAAACCTGCAGGAG -3'
(R):5'- GTCACTCCTACAGAAGTGCTTGAG -3'
Posted On2018-03-15