Incidental Mutation 'R6289:Mks1'
ID508312
Institutional Source Beutler Lab
Gene Symbol Mks1
Ensembl Gene ENSMUSG00000034121
Gene NameMeckel syndrome, type 1
SynonymsB8d3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87853215-87863803 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 87859659 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038196] [ENSMUST00000038196] [ENSMUST00000049768]
Predicted Effect probably null
Transcript: ENSMUST00000038196
SMART Domains Protein: ENSMUSP00000043790
Gene: ENSMUSG00000034121

DomainStartEndE-ValueType
low complexity region 163 170 N/A INTRINSIC
Pfam:B9-C2 316 496 1.8e-45 PFAM
low complexity region 533 547 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000038196
SMART Domains Protein: ENSMUSP00000043790
Gene: ENSMUSG00000034121

DomainStartEndE-ValueType
low complexity region 163 170 N/A INTRINSIC
Pfam:B9-C2 316 496 1.8e-45 PFAM
low complexity region 533 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049768
SMART Domains Protein: ENSMUSP00000050497
Gene: ENSMUSG00000052234

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 146 690 8.3e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153729
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in this gene result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit polydactyly, heterotaxia, skeletal defects, and kidney cysts along with abnormal lung, kidney, liver, and heart morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Mks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Mks1 APN 11 87856863 missense probably benign 0.28
IGL02291:Mks1 APN 11 87859667 unclassified probably benign
IGL02406:Mks1 APN 11 87862785 missense probably benign 0.02
IGL02938:Mks1 APN 11 87862652 critical splice donor site probably null
IGL03094:Mks1 APN 11 87855465 splice site probably benign
R0389:Mks1 UTSW 11 87857928 missense probably benign
R0893:Mks1 UTSW 11 87856951 splice site probably benign
R1490:Mks1 UTSW 11 87862769 missense probably benign 0.02
R1514:Mks1 UTSW 11 87861111 missense probably benign 0.31
R2042:Mks1 UTSW 11 87856668 splice site probably benign
R4289:Mks1 UTSW 11 87856704 intron probably benign
R4757:Mks1 UTSW 11 87863024 makesense probably null
R4868:Mks1 UTSW 11 87853723 splice site probably benign
R5243:Mks1 UTSW 11 87856678 intron probably benign
R5708:Mks1 UTSW 11 87856839 missense probably benign 0.21
R5848:Mks1 UTSW 11 87856870 missense probably benign 0.00
R6320:Mks1 UTSW 11 87855499 missense probably benign 0.00
R7205:Mks1 UTSW 11 87856602 missense probably benign 0.02
R7642:Mks1 UTSW 11 87856840 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTGCGGTGTCAGAAATAGG -3'
(R):5'- TCAGTCTCGTCTTGAAGGGTC -3'

Sequencing Primer
(F):5'- TCAGAAATAGGAAAGCGTCTTGTTG -3'
(R):5'- GTCTTGAAGGGTCCAAATGCTCTAC -3'
Posted On2018-03-15