Incidental Mutation 'R6289:Adam21'
ID508314
Institutional Source Beutler Lab
Gene Symbol Adam21
Ensembl Gene ENSMUSG00000008438
Gene Namea disintegrin and metallopeptidase domain 21
SynonymsADAM31
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81558584-81568474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81560706 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000008582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008582]
Predicted Effect probably damaging
Transcript: ENSMUST00000008582
AA Change: V94A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008582
Gene: ENSMUSG00000008438
AA Change: V94A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 164 5.1e-21 PFAM
Pfam:Reprolysin_4 212 389 2.5e-11 PFAM
Pfam:Reprolysin 212 402 7.3e-50 PFAM
Pfam:Reprolysin_5 214 400 5.8e-19 PFAM
Pfam:Reprolysin_2 233 393 1.3e-14 PFAM
Pfam:Reprolysin_3 236 356 6.5e-16 PFAM
DISIN 419 494 2.45e-37 SMART
ACR 495 631 6.49e-62 SMART
EGF 637 667 2.03e1 SMART
transmembrane domain 687 709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166971
Meta Mutation Damage Score 0.2027 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. The encoded protein functions in the regulation of spermatogenesis in the testes and neurogenesis in the central nervous system. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Adam21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Adam21 APN 12 81559209 missense possibly damaging 0.61
IGL02311:Adam21 APN 12 81560892 missense probably benign 0.01
IGL03132:Adam21 APN 12 81560374 nonsense probably null
IGL03225:Adam21 APN 12 81559269 missense probably benign 0.00
BB009:Adam21 UTSW 12 81560164 missense probably damaging 0.98
BB019:Adam21 UTSW 12 81560164 missense probably damaging 0.98
R0305:Adam21 UTSW 12 81560285 missense possibly damaging 0.96
R0634:Adam21 UTSW 12 81560352 missense probably benign 0.01
R1415:Adam21 UTSW 12 81559547 nonsense probably null
R1961:Adam21 UTSW 12 81559508 nonsense probably null
R1996:Adam21 UTSW 12 81559602 missense possibly damaging 0.79
R2159:Adam21 UTSW 12 81560467 missense probably benign 0.17
R2215:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R3780:Adam21 UTSW 12 81559273 missense probably damaging 1.00
R3964:Adam21 UTSW 12 81560809 missense possibly damaging 0.46
R4356:Adam21 UTSW 12 81558820 missense probably damaging 0.99
R4503:Adam21 UTSW 12 81560898 missense probably benign
R4795:Adam21 UTSW 12 81560974 missense probably benign 0.06
R4925:Adam21 UTSW 12 81560389 missense probably benign
R4932:Adam21 UTSW 12 81558918 missense probably benign 0.14
R5110:Adam21 UTSW 12 81560215 missense probably benign 0.40
R5831:Adam21 UTSW 12 81559101 missense probably benign 0.06
R6500:Adam21 UTSW 12 81559606 missense probably benign 0.01
R7077:Adam21 UTSW 12 81559119 missense probably damaging 1.00
R7083:Adam21 UTSW 12 81560241 missense possibly damaging 0.81
R7173:Adam21 UTSW 12 81559234 missense probably benign 0.24
R7176:Adam21 UTSW 12 81560248 missense possibly damaging 0.94
R7232:Adam21 UTSW 12 81560556 missense probably damaging 0.99
R7371:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R7486:Adam21 UTSW 12 81558883 missense probably benign 0.00
R7522:Adam21 UTSW 12 81558948 missense possibly damaging 0.78
R7918:Adam21 UTSW 12 81560604 missense possibly damaging 0.64
R7932:Adam21 UTSW 12 81560164 missense probably damaging 0.98
R8040:Adam21 UTSW 12 81560437 missense probably benign 0.04
R8486:Adam21 UTSW 12 81560776 missense probably benign 0.08
R8750:Adam21 UTSW 12 81560473 nonsense probably null
R8881:Adam21 UTSW 12 81559876 missense probably benign 0.02
Z1088:Adam21 UTSW 12 81560686 missense probably damaging 1.00
Z1176:Adam21 UTSW 12 81559743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACTAGGTGCTCGAATGTGC -3'
(R):5'- TTGACCTCTCACAGACTGGG -3'

Sequencing Primer
(F):5'- ACTAGGTGCTCGAATGTGCTAGAG -3'
(R):5'- TGGGTCCACTCAATACCTCAG -3'
Posted On2018-03-15