Incidental Mutation 'R6289:Fgf10'
ID508316
Institutional Source Beutler Lab
Gene Symbol Fgf10
Ensembl Gene ENSMUSG00000021732
Gene Namefibroblast growth factor 10
SynonymsGsfaey17, AEY17, FGF-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location118669791-118792115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118715492 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 37 (Q37K)
Ref Sequence ENSEMBL: ENSMUSP00000022246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022246]
Predicted Effect probably benign
Transcript: ENSMUST00000022246
AA Change: Q37K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000022246
Gene: ENSMUSG00000021732
AA Change: Q37K

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
FGF 77 206 9.61e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146674
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. Studies of the mouse homolog of suggested that this gene is required for embryonic epidermal morphogenesis including brain development, lung morphogenesis, and initiation of lim bud formation. This gene is also implicated to be a primary factor in the process of wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die at birth with multiple abnormalities including absence of lungs, severely truncated limbs, open eyelids, incomplete external genitalia, arrested pancreatic development, lack of mammary glands and impaired epidermal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Fgf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03400:Fgf10 APN 13 118781615 splice site probably null
BB003:Fgf10 UTSW 13 118789216 missense probably damaging 1.00
BB013:Fgf10 UTSW 13 118789216 missense probably damaging 1.00
R0487:Fgf10 UTSW 13 118781611 critical splice donor site probably null
R0789:Fgf10 UTSW 13 118789205 missense probably benign
R1876:Fgf10 UTSW 13 118789159 missense probably damaging 1.00
R1939:Fgf10 UTSW 13 118789152 missense probably damaging 1.00
R2032:Fgf10 UTSW 13 118715595 missense probably damaging 1.00
R3768:Fgf10 UTSW 13 118781547 missense probably damaging 1.00
R3769:Fgf10 UTSW 13 118781547 missense probably damaging 1.00
R4756:Fgf10 UTSW 13 118781509 missense probably benign 0.03
R5992:Fgf10 UTSW 13 118715508 missense probably benign 0.00
R6301:Fgf10 UTSW 13 118715511 missense probably benign 0.02
R6755:Fgf10 UTSW 13 118789285 missense probably damaging 1.00
R7174:Fgf10 UTSW 13 118715406 missense probably benign 0.39
R7189:Fgf10 UTSW 13 118789123 missense probably benign 0.02
R7926:Fgf10 UTSW 13 118789216 missense probably damaging 1.00
R8407:Fgf10 UTSW 13 118715402 missense possibly damaging 0.93
R8557:Fgf10 UTSW 13 118781596 missense probably benign 0.00
R8831:Fgf10 UTSW 13 118789135 missense probably damaging 1.00
X0024:Fgf10 UTSW 13 118715544 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGGTCTTACCCTTCCAG -3'
(R):5'- CGCATTTGTTACTTACTGTACGG -3'

Sequencing Primer
(F):5'- CCAGTATGTTCCTTCTGATGAGAC -3'
(R):5'- ACGGACAGTCTTCATTCTTGG -3'
Posted On2018-03-15