Incidental Mutation 'R6289:Blk'
ID508318
Institutional Source Beutler Lab
Gene Symbol Blk
Ensembl Gene ENSMUSG00000014453
Gene NameB lymphoid kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6289 (G1)
Quality Score210.009
Status Validated
Chromosome14
Chromosomal Location63372836-63417037 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 63375892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014597]
PDB Structure NMR ENSEMBLE OF BLK SH2 DOMAIN, 20 STRUCTURES [SOLUTION NMR]
NMR ENSEMBLE OF BLK SH2 DOMAIN USING CHEMICAL SHIFT REFINEMENT, 20 STRUCTURES [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000014597
SMART Domains Protein: ENSMUSP00000014597
Gene: ENSMUSG00000014453

DomainStartEndE-ValueType
SH3 55 111 2.91e-18 SMART
SH2 116 205 1.32e-32 SMART
TyrKc 235 484 1.97e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224965
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nonreceptor tyrosine-kinase of the src family of proto-oncogenes that are typically involved in cell proliferation and differentiation. The protein has a role in B-cell receptor signaling and B-cell development. The protein also stimulates insulin synthesis and secretion in response to glucose and enhances the expression of several pancreatic beta-cell transcription factors. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Blk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Blk APN 14 63380720 missense probably damaging 1.00
IGL02146:Blk APN 14 63374199 missense probably damaging 1.00
IGL02684:Blk APN 14 63379694 missense probably benign 0.17
blaenka UTSW 14 63384002 missense probably damaging 1.00
BB009:Blk UTSW 14 63373559 missense possibly damaging 0.67
BB019:Blk UTSW 14 63373559 missense possibly damaging 0.67
R0254:Blk UTSW 14 63380804 missense probably benign 0.08
R0318:Blk UTSW 14 63374197 missense probably damaging 1.00
R1567:Blk UTSW 14 63380729 missense probably damaging 0.99
R1871:Blk UTSW 14 63375915 missense possibly damaging 0.72
R3719:Blk UTSW 14 63384002 missense probably damaging 1.00
R4606:Blk UTSW 14 63374203 missense probably benign 0.00
R4879:Blk UTSW 14 63375965 missense probably benign
R4935:Blk UTSW 14 63381262 missense possibly damaging 0.95
R5014:Blk UTSW 14 63379787 missense probably benign 0.00
R5352:Blk UTSW 14 63375971 missense probably damaging 1.00
R5406:Blk UTSW 14 63380731 missense probably damaging 1.00
R5514:Blk UTSW 14 63378481 missense probably damaging 0.99
R5518:Blk UTSW 14 63378507 missense possibly damaging 0.56
R6743:Blk UTSW 14 63384926 missense probably benign
R7932:Blk UTSW 14 63373559 missense possibly damaging 0.67
R8696:Blk UTSW 14 63380700 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGGGCTTGAGTTGCTTC -3'
(R):5'- CTGGCCTTATGAGCTGGTAG -3'

Sequencing Primer
(F):5'- CCATCTAGGGAAAGGAAGTGCTG -3'
(R):5'- AGCTGGTAGGCTCCATCCTTG -3'
Posted On2018-03-15