Incidental Mutation 'R6289:Vmn2r106'
ID508323
Institutional Source Beutler Lab
Gene Symbol Vmn2r106
Ensembl Gene ENSMUSG00000091656
Gene Namevomeronasal 2, receptor 106
SynonymsEG224576
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20267547-20285430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20268463 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 558 (C558Y)
Ref Sequence ENSEMBL: ENSMUSP00000126534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167464]
Predicted Effect probably damaging
Transcript: ENSMUST00000167464
AA Change: C558Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126534
Gene: ENSMUSG00000091656
AA Change: C558Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 471 3.8e-37 PFAM
Pfam:NCD3G 514 567 5.7e-22 PFAM
Pfam:7tm_3 596 835 1.3e-49 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Vmn2r106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Vmn2r106 APN 17 20277575 missense possibly damaging 0.90
IGL01313:Vmn2r106 APN 17 20278389 missense probably damaging 0.99
IGL01419:Vmn2r106 APN 17 20279545 missense probably benign 0.06
IGL01574:Vmn2r106 APN 17 20268310 missense possibly damaging 0.94
IGL01796:Vmn2r106 APN 17 20268052 missense possibly damaging 0.79
IGL01893:Vmn2r106 APN 17 20277468 missense probably benign 0.06
IGL01895:Vmn2r106 APN 17 20278965 missense probably benign 0.02
IGL02378:Vmn2r106 APN 17 20277529 missense probably damaging 1.00
IGL02430:Vmn2r106 APN 17 20278896 missense probably benign 0.38
IGL02664:Vmn2r106 APN 17 20268082 missense possibly damaging 0.88
IGL03308:Vmn2r106 APN 17 20278523 nonsense probably null
IGL03384:Vmn2r106 APN 17 20268143 missense probably damaging 0.99
R0401:Vmn2r106 UTSW 17 20279019 missense possibly damaging 0.86
R0842:Vmn2r106 UTSW 17 20268203 missense probably damaging 1.00
R0964:Vmn2r106 UTSW 17 20267597 missense probably benign 0.00
R1235:Vmn2r106 UTSW 17 20279479 missense probably benign 0.00
R1709:Vmn2r106 UTSW 17 20279111 missense probably benign 0.12
R1712:Vmn2r106 UTSW 17 20278735 missense probably benign 0.01
R1770:Vmn2r106 UTSW 17 20268298 missense probably damaging 0.99
R2049:Vmn2r106 UTSW 17 20268304 missense possibly damaging 0.90
R2245:Vmn2r106 UTSW 17 20268161 missense probably benign 0.13
R2336:Vmn2r106 UTSW 17 20268208 missense probably benign 0.18
R2910:Vmn2r106 UTSW 17 20278684 missense probably damaging 1.00
R3025:Vmn2r106 UTSW 17 20278885 missense probably benign 0.00
R3944:Vmn2r106 UTSW 17 20267651 missense probably damaging 1.00
R4081:Vmn2r106 UTSW 17 20267556 nonsense probably null
R4153:Vmn2r106 UTSW 17 20267818 missense probably damaging 1.00
R4356:Vmn2r106 UTSW 17 20279648 missense probably benign 0.06
R4426:Vmn2r106 UTSW 17 20285379 missense probably benign 0.00
R4590:Vmn2r106 UTSW 17 20277466 missense probably damaging 0.99
R4661:Vmn2r106 UTSW 17 20267623 missense probably benign 0.10
R5106:Vmn2r106 UTSW 17 20279133 critical splice acceptor site probably null
R5341:Vmn2r106 UTSW 17 20277526 missense probably benign 0.00
R5509:Vmn2r106 UTSW 17 20278422 missense probably damaging 0.99
R5826:Vmn2r106 UTSW 17 20278871 missense probably benign
R5859:Vmn2r106 UTSW 17 20285321 missense possibly damaging 0.72
R5937:Vmn2r106 UTSW 17 20285405 nonsense probably null
R5972:Vmn2r106 UTSW 17 20278476 missense probably benign
R6056:Vmn2r106 UTSW 17 20267544 splice site probably null
R6108:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6114:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6115:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6132:Vmn2r106 UTSW 17 20268404 missense probably benign
R6208:Vmn2r106 UTSW 17 20268329 missense probably damaging 0.99
R6217:Vmn2r106 UTSW 17 20268239 missense probably benign 0.10
R6378:Vmn2r106 UTSW 17 20278405 missense probably benign 0.19
R6390:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6391:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6392:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6405:Vmn2r106 UTSW 17 20279099 missense probably benign 0.22
R6427:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6428:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6435:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6436:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6437:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6511:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6512:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6587:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6703:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6730:Vmn2r106 UTSW 17 20278834 missense possibly damaging 0.64
R6961:Vmn2r106 UTSW 17 20268384 nonsense probably null
R7054:Vmn2r106 UTSW 17 20278920 missense probably damaging 0.96
R7379:Vmn2r106 UTSW 17 20267775 missense possibly damaging 0.75
R7402:Vmn2r106 UTSW 17 20267621 missense probably damaging 0.99
R7497:Vmn2r106 UTSW 17 20267939 missense probably damaging 1.00
R7692:Vmn2r106 UTSW 17 20285228 missense possibly damaging 0.96
R8539:Vmn2r106 UTSW 17 20279009 missense probably benign 0.00
R8827:Vmn2r106 UTSW 17 20267606 missense probably benign 0.05
R8872:Vmn2r106 UTSW 17 20268139 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGAGAGCTCGGTTATTGGCC -3'
(R):5'- AGGCTAGTTCAACTTCAGTCAG -3'

Sequencing Primer
(F):5'- GCCTTGACAATAGGAGTGTCTC -3'
(R):5'- GTTCAACTTCAGTCAGTATAAGGAAG -3'
Posted On2018-03-15