Incidental Mutation 'R6289:Tdrd6'
ID508325
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Nametudor domain containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location43615335-43630299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43624520 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1879 (M1879T)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
Predicted Effect probably benign
Transcript: ENSMUST00000045717
AA Change: M1879T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: M1879T

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162232
Predicted Effect probably benign
Transcript: ENSMUST00000168073
AA Change: M1879T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: M1879T

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Keg1 T G 19: 12,714,573 C85G probably damaging Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43628160 missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43617196 missense probably benign
IGL00845:Tdrd6 APN 17 43626716 missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43625768 missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43624766 missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43627980 missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43625174 missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43625946 missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43628209 missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43629351 missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43628390 missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43627202 missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43624738 missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43626837 missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43626219 missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43620446 missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43625027 missense probably benign
IGL02929:Tdrd6 APN 17 43629713 missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43627887 missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43627262 missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43627549 missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43625432 missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43625507 missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43627964 missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43625568 missense probably damaging 1.00
Elizabeth UTSW 17 43624204 missense probably benign 0.00
henry UTSW 17 43628159 missense probably damaging 0.99
BB001:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
BB011:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
G1citation:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43626591 missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43617161 splice site probably benign
R0090:Tdrd6 UTSW 17 43628241 missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43624308 missense probably benign
R0463:Tdrd6 UTSW 17 43625561 missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43629383 missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43628159 missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43626632 missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43626621 missense probably benign
R1483:Tdrd6 UTSW 17 43627607 missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43628327 missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43626551 missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43625589 missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43624805 missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43627088 missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43626467 missense probably damaging 0.98
R2005:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2006:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43628042 missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43625973 missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43628754 missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43625990 missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43624116 missense probably benign
R4676:Tdrd6 UTSW 17 43627610 missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43625576 missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43624327 missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43626210 missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43626075 missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43629333 missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43626408 missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43624877 missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43628411 missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43629482 missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43628897 missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6315:Tdrd6 UTSW 17 43626338 missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43628961 missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43624532 missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43627708 missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43625174 missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43624204 missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43626093 missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43625046 missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43627679 missense not run
R7583:Tdrd6 UTSW 17 43624238 missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43625960 missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43624839 missense probably benign 0.00
R7924:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
R8002:Tdrd6 UTSW 17 43629819 missense probably damaging 0.98
R8134:Tdrd6 UTSW 17 43626173 missense probably damaging 0.99
R8231:Tdrd6 UTSW 17 43622135 missense probably damaging 1.00
R8242:Tdrd6 UTSW 17 43628930 missense probably damaging 1.00
R8542:Tdrd6 UTSW 17 43624892 missense probably damaging 1.00
R8713:Tdrd6 UTSW 17 43625019 missense probably benign 0.28
X0065:Tdrd6 UTSW 17 43625153 missense possibly damaging 0.80
X0065:Tdrd6 UTSW 17 43625993 missense probably damaging 0.99
Z1088:Tdrd6 UTSW 17 43626518 missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43627187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGAAGAGCCCATGTAGCC -3'
(R):5'- TATTGGCCCATGCTAGTGAG -3'

Sequencing Primer
(F):5'- CCGAATACCTGGATTCCTGGATG -3'
(R):5'- CTAGTGAGCCAAAGGAGTTACTG -3'
Posted On2018-03-15