Incidental Mutation 'R6289:Keg1'
ID508326
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Namekidney expressed gene 1
Synonyms0610008P16Rik, GS4059
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6289 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12695786-12719902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12714573 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 85 (C85G)
Ref Sequence ENSEMBL: ENSMUSP00000025598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
Predicted Effect probably damaging
Transcript: ENSMUST00000025598
AA Change: C85G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694
AA Change: C85G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128987
Predicted Effect possibly damaging
Transcript: ENSMUST00000138545
AA Change: C75G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694
AA Change: C75G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152017
Predicted Effect probably damaging
Transcript: ENSMUST00000154822
AA Change: C75G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694
AA Change: C75G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,560,706 V94A probably damaging Het
Ankrd36 T C 11: 5,628,837 S34P probably damaging Het
Arid3c G A 4: 41,724,285 probably benign Het
Atg16l1 C T 1: 87,756,215 R6C probably damaging Het
Bex6 A G 16: 32,186,712 I113V probably benign Het
Blk T C 14: 63,375,892 probably null Het
C1s1 A G 6: 124,531,176 F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 H215Y probably damaging Het
Casp9 T A 4: 141,807,185 V302E probably damaging Het
Ccl2 A C 11: 82,036,969 K80Q probably benign Het
Cit T G 5: 116,006,326 *2014E probably null Het
Dclk2 A T 3: 86,831,817 S292T probably benign Het
Ddx23 T C 15: 98,649,884 E463G probably benign Het
Dennd1b T C 1: 139,168,945 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fgf10 C A 13: 118,715,492 Q37K probably benign Het
Fgf22 A G 10: 79,755,207 D24G probably damaging Het
Gabra1 A G 11: 42,155,019 I88T probably damaging Het
Grip2 A G 6: 91,778,871 I586T probably benign Het
Hist1h1b G T 13: 21,780,439 P39Q probably damaging Het
Hpse2 T A 19: 42,788,979 N583Y probably null Het
Katnal2 A G 18: 77,017,455 probably null Het
Kidins220 T A 12: 25,056,616 L1356H probably damaging Het
Lifr A G 15: 7,166,910 K192E probably benign Het
Mks1 T C 11: 87,859,659 probably null Het
Olfr1464-ps1 T C 19: 13,282,794 K88R possibly damaging Het
Rars C T 11: 35,826,067 M207I probably damaging Het
Rbm6 T C 9: 107,777,948 Y896C probably damaging Het
Scarf1 T A 11: 75,525,416 W472R possibly damaging Het
Sept8 A G 11: 53,534,478 N66S probably damaging Het
Smcr8 T C 11: 60,778,598 F191L probably damaging Het
Tdrd6 A G 17: 43,624,520 M1879T probably benign Het
Tlr3 C T 8: 45,396,929 R901Q probably benign Het
Trpc4ap T C 2: 155,663,707 T203A possibly damaging Het
Tubgcp5 A G 7: 55,795,923 S58G probably benign Het
Ubtd2 A G 11: 32,516,177 E132G probably damaging Het
Uggt2 T A 14: 119,041,602 E831V probably damaging Het
Umodl1 A G 17: 30,982,351 N418S probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Wdhd1 A C 14: 47,258,496 I637S possibly damaging Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12719000 missense probably damaging 1.00
IGL01084:Keg1 APN 19 12714612 missense probably damaging 1.00
IGL02563:Keg1 APN 19 12719157 missense probably damaging 1.00
IGL03328:Keg1 APN 19 12719097 missense probably damaging 1.00
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12711060 missense probably damaging 1.00
R1300:Keg1 UTSW 19 12719004 missense probably damaging 0.98
R1476:Keg1 UTSW 19 12716023 missense probably benign
R1482:Keg1 UTSW 19 12718821 missense probably damaging 1.00
R1643:Keg1 UTSW 19 12719042 missense probably benign 0.00
R4002:Keg1 UTSW 19 12718943 missense possibly damaging 0.95
R5022:Keg1 UTSW 19 12719157 missense probably damaging 1.00
R5164:Keg1 UTSW 19 12714680 intron probably benign
R5386:Keg1 UTSW 19 12714538 missense probably damaging 1.00
R6517:Keg1 UTSW 19 12715910 missense probably benign 0.00
R6656:Keg1 UTSW 19 12709630 nonsense probably null
R7117:Keg1 UTSW 19 12709678 missense probably damaging 1.00
R7676:Keg1 UTSW 19 12716045 missense probably benign 0.00
R7807:Keg1 UTSW 19 12714634 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCAGAGCAAGTTATACTTTC -3'
(R):5'- GTAACTCAAGGGTTCCTTTTGG -3'

Sequencing Primer
(F):5'- CTGGACTCACTTTGTAGACCAGG -3'
(R):5'- CAGCCTGCTCAGTGTCTGTG -3'
Posted On2018-03-15