Incidental Mutation 'R6289:Keg1'
ID 508326
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Name kidney expressed gene 1
Synonyms 0610008P16Rik, GS4059
MMRRC Submission 044459-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6289 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 12673154-12697266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12691937 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 85 (C85G)
Ref Sequence ENSEMBL: ENSMUSP00000025598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
AlphaFold Q9DCY0
Predicted Effect probably damaging
Transcript: ENSMUST00000025598
AA Change: C85G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694
AA Change: C85G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128987
Predicted Effect possibly damaging
Transcript: ENSMUST00000138545
AA Change: C75G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694
AA Change: C75G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152017
Predicted Effect probably damaging
Transcript: ENSMUST00000154822
AA Change: C75G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694
AA Change: C75G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,607,480 (GRCm39) V94A probably damaging Het
Ankrd36 T C 11: 5,578,837 (GRCm39) S34P probably damaging Het
Arid3c G A 4: 41,724,285 (GRCm39) probably benign Het
Atg16l1 C T 1: 87,683,937 (GRCm39) R6C probably damaging Het
Bex6 A G 16: 32,005,530 (GRCm39) I113V probably benign Het
Blk T C 14: 63,613,341 (GRCm39) probably null Het
C1s1 A G 6: 124,508,135 (GRCm39) F618S probably damaging Het
Casp8ap2 C T 4: 32,639,590 (GRCm39) H215Y probably damaging Het
Casp9 T A 4: 141,534,496 (GRCm39) V302E probably damaging Het
Ccl2 A C 11: 81,927,795 (GRCm39) K80Q probably benign Het
Cit T G 5: 116,144,385 (GRCm39) *2014E probably null Het
Dclk2 A T 3: 86,739,124 (GRCm39) S292T probably benign Het
Ddx23 T C 15: 98,547,765 (GRCm39) E463G probably benign Het
Dennd1b T C 1: 139,096,683 (GRCm39) probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fgf10 C A 13: 118,852,028 (GRCm39) Q37K probably benign Het
Fgf22 A G 10: 79,591,041 (GRCm39) D24G probably damaging Het
Gabra1 A G 11: 42,045,846 (GRCm39) I88T probably damaging Het
Grip2 A G 6: 91,755,852 (GRCm39) I586T probably benign Het
H1f5 G T 13: 21,964,609 (GRCm39) P39Q probably damaging Het
Hpse2 T A 19: 42,777,418 (GRCm39) N583Y probably null Het
Katnal2 A G 18: 77,105,151 (GRCm39) probably null Het
Kidins220 T A 12: 25,106,615 (GRCm39) L1356H probably damaging Het
Lifr A G 15: 7,196,391 (GRCm39) K192E probably benign Het
Mks1 T C 11: 87,750,485 (GRCm39) probably null Het
Or5b110-ps1 T C 19: 13,260,158 (GRCm39) K88R possibly damaging Het
Rars1 C T 11: 35,716,894 (GRCm39) M207I probably damaging Het
Rbm6 T C 9: 107,655,147 (GRCm39) Y896C probably damaging Het
Scarf1 T A 11: 75,416,242 (GRCm39) W472R possibly damaging Het
Septin8 A G 11: 53,425,305 (GRCm39) N66S probably damaging Het
Smcr8 T C 11: 60,669,424 (GRCm39) F191L probably damaging Het
Tdrd6 A G 17: 43,935,411 (GRCm39) M1879T probably benign Het
Tlr3 C T 8: 45,849,966 (GRCm39) R901Q probably benign Het
Trpc4ap T C 2: 155,505,627 (GRCm39) T203A possibly damaging Het
Tubgcp5 A G 7: 55,445,671 (GRCm39) S58G probably benign Het
Ubtd2 A G 11: 32,466,177 (GRCm39) E132G probably damaging Het
Uggt2 T A 14: 119,279,014 (GRCm39) E831V probably damaging Het
Umodl1 A G 17: 31,201,325 (GRCm39) N418S probably benign Het
Vmn2r106 C T 17: 20,488,725 (GRCm39) C558Y probably damaging Het
Wdhd1 A C 14: 47,495,953 (GRCm39) I637S possibly damaging Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12,696,364 (GRCm39) missense probably damaging 1.00
IGL01084:Keg1 APN 19 12,691,976 (GRCm39) missense probably damaging 1.00
IGL02563:Keg1 APN 19 12,696,521 (GRCm39) missense probably damaging 1.00
IGL03328:Keg1 APN 19 12,696,461 (GRCm39) missense probably damaging 1.00
R0103:Keg1 UTSW 19 12,696,280 (GRCm39) missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12,696,280 (GRCm39) missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12,688,424 (GRCm39) missense probably damaging 1.00
R1300:Keg1 UTSW 19 12,696,368 (GRCm39) missense probably damaging 0.98
R1476:Keg1 UTSW 19 12,693,387 (GRCm39) missense probably benign
R1482:Keg1 UTSW 19 12,696,185 (GRCm39) missense probably damaging 1.00
R1643:Keg1 UTSW 19 12,696,406 (GRCm39) missense probably benign 0.00
R4002:Keg1 UTSW 19 12,696,307 (GRCm39) missense possibly damaging 0.95
R5022:Keg1 UTSW 19 12,696,521 (GRCm39) missense probably damaging 1.00
R5164:Keg1 UTSW 19 12,692,044 (GRCm39) intron probably benign
R5386:Keg1 UTSW 19 12,691,902 (GRCm39) missense probably damaging 1.00
R6517:Keg1 UTSW 19 12,693,274 (GRCm39) missense probably benign 0.00
R6656:Keg1 UTSW 19 12,686,994 (GRCm39) nonsense probably null
R7117:Keg1 UTSW 19 12,687,042 (GRCm39) missense probably damaging 1.00
R7676:Keg1 UTSW 19 12,693,409 (GRCm39) missense probably benign 0.00
R7807:Keg1 UTSW 19 12,691,998 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCAGAGCAAGTTATACTTTC -3'
(R):5'- GTAACTCAAGGGTTCCTTTTGG -3'

Sequencing Primer
(F):5'- CTGGACTCACTTTGTAGACCAGG -3'
(R):5'- CAGCCTGCTCAGTGTCTGTG -3'
Posted On 2018-03-15