Incidental Mutation 'R6290:Slc45a1'
ID508349
Institutional Source Beutler Lab
Gene Symbol Slc45a1
Ensembl Gene ENSMUSG00000039838
Gene Namesolute carrier family 45, member 1
SynonymsDnb5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location150628572-150652174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150642639 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 174 (N174K)
Ref Sequence ENSEMBL: ENSMUSP00000036774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037827] [ENSMUST00000117997]
Predicted Effect probably damaging
Transcript: ENSMUST00000037827
AA Change: N174K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036774
Gene: ENSMUSG00000039838
AA Change: N174K

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 86 310 7.3e-11 PFAM
Pfam:MFS_1 92 356 1.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 680 702 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117997
AA Change: N174K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112737
Gene: ENSMUSG00000039838
AA Change: N174K

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 87 307 1.6e-12 PFAM
Pfam:MFS_1 92 362 2.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147706
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was isolated initially from a region on chromosome 1p that is frequently deleted in human neuroblastoma, although no causal relationship has since been demonstrated. The encoded protein belongs to the glycoside-pentoside-hexuronide cation symporter transporter family and may play a role in glucose uptake. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Slc45a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Slc45a1 APN 4 150643969 missense probably damaging 1.00
IGL02009:Slc45a1 APN 4 150637990 missense probably damaging 1.00
IGL02251:Slc45a1 APN 4 150638719 splice site probably benign
IGL02752:Slc45a1 APN 4 150638021 missense probably benign 0.01
IGL02881:Slc45a1 APN 4 150638530 missense probably benign 0.36
PIT4508001:Slc45a1 UTSW 4 150638435 missense probably benign 0.00
R0017:Slc45a1 UTSW 4 150629566 missense possibly damaging 0.56
R0017:Slc45a1 UTSW 4 150629566 missense possibly damaging 0.56
R0449:Slc45a1 UTSW 4 150643305 missense probably damaging 1.00
R0756:Slc45a1 UTSW 4 150642597 frame shift probably null
R1435:Slc45a1 UTSW 4 150644048 missense probably damaging 1.00
R1837:Slc45a1 UTSW 4 150638459 missense probably benign 0.00
R1943:Slc45a1 UTSW 4 150644277 missense probably benign 0.02
R2186:Slc45a1 UTSW 4 150638251 missense probably benign 0.01
R3766:Slc45a1 UTSW 4 150638060 missense probably damaging 1.00
R4689:Slc45a1 UTSW 4 150638539 missense probably benign 0.31
R4697:Slc45a1 UTSW 4 150638284 missense probably damaging 1.00
R4709:Slc45a1 UTSW 4 150638240 missense probably benign 0.04
R5253:Slc45a1 UTSW 4 150638270 missense probably damaging 0.98
R5387:Slc45a1 UTSW 4 150643909 intron probably benign
R5914:Slc45a1 UTSW 4 150629540 missense possibly damaging 0.57
R6259:Slc45a1 UTSW 4 150638360 missense possibly damaging 0.63
R6961:Slc45a1 UTSW 4 150629653 missense probably damaging 0.99
R6981:Slc45a1 UTSW 4 150638594 missense possibly damaging 0.48
R7099:Slc45a1 UTSW 4 150629573 missense probably benign 0.00
R7209:Slc45a1 UTSW 4 150635212 intron probably null
R7601:Slc45a1 UTSW 4 150629537 missense possibly damaging 0.78
R7615:Slc45a1 UTSW 4 150638545 missense probably benign 0.01
R7730:Slc45a1 UTSW 4 150630940 missense probably damaging 1.00
R7750:Slc45a1 UTSW 4 150644041 missense probably damaging 1.00
X0026:Slc45a1 UTSW 4 150644050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAGGGCATGGATGTTCAG -3'
(R):5'- AACTCTGCATGTCTGTAGGCAAC -3'

Sequencing Primer
(F):5'- GCATGGATGTTCAGGCCTC -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'
Posted On2018-03-15