Incidental Mutation 'R6290:Paxip1'
ID508351
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene NamePAX interacting (with transcription-activation domain) protein 1
SynonymsD5Ertd149e, PTIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location27740080-27791691 bp(-) (GRCm38)
Type of Mutationsplice site (13 bp from exon)
DNA Base Change (assembly) A to T at 27765578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291]
Predicted Effect probably null
Transcript: ENSMUST00000002291
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196641
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27772552 utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27748859 missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27751038 missense probably benign 0.17
IGL02143:Paxip1 APN 5 27775598 utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27759395 missense probably benign 0.30
IGL02903:Paxip1 APN 5 27748872 missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27752766 missense probably benign 0.01
BB003:Paxip1 UTSW 5 27791209 missense unknown
BB013:Paxip1 UTSW 5 27791209 missense unknown
R0128:Paxip1 UTSW 5 27744185 splice site probably benign
R0130:Paxip1 UTSW 5 27744185 splice site probably benign
R0331:Paxip1 UTSW 5 27765232 missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27758623 splice site probably benign
R0370:Paxip1 UTSW 5 27760086 missense probably damaging 1.00
R0625:Paxip1 UTSW 5 27765942 nonsense probably null
R1969:Paxip1 UTSW 5 27744136 missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27742501 missense probably damaging 1.00
R3424:Paxip1 UTSW 5 27775673 utr 3 prime probably benign
R3808:Paxip1 UTSW 5 27772029 unclassified probably benign
R3809:Paxip1 UTSW 5 27772029 unclassified probably benign
R3881:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R3882:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27761677 splice site probably null
R4692:Paxip1 UTSW 5 27772097 unclassified probably benign
R4776:Paxip1 UTSW 5 27765206 missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27766284 missense unknown
R5388:Paxip1 UTSW 5 27781455 utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27772004 unclassified probably benign
R5553:Paxip1 UTSW 5 27775639 utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27761618 missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27766173 missense unknown
R6276:Paxip1 UTSW 5 27761668 missense probably damaging 1.00
R6584:Paxip1 UTSW 5 27758452 missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27744137 missense probably benign 0.18
R6908:Paxip1 UTSW 5 27791224 missense possibly damaging 0.90
R6981:Paxip1 UTSW 5 27765768 nonsense probably null
R7252:Paxip1 UTSW 5 27760086 missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27781420 critical splice donor site probably null
R7585:Paxip1 UTSW 5 27772004 missense unknown
R7665:Paxip1 UTSW 5 27765738 missense unknown
R7926:Paxip1 UTSW 5 27791209 missense unknown
R8169:Paxip1 UTSW 5 27772095 missense unknown
R8335:Paxip1 UTSW 5 27766124 missense unknown
X0066:Paxip1 UTSW 5 27766018 missense unknown
Z1176:Paxip1 UTSW 5 27783729 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAGCCTTCATACTCTGTGAAC -3'
(R):5'- GTTAGCACAGCTCCAGCAAC -3'

Sequencing Primer
(F):5'- TGAACACTGGTCCTCACTGCAG -3'
(R):5'- TCCAACGCTTGCAGCAG -3'
Posted On2018-03-15