Mutagenetix > Incidental Mutation

Incidental Mutation 'R6290:Cntn6'

508360

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R6290 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104767890 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 315 (Y315N)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably damaging
Transcript: ENSMUST00000089215
AA Change: Y315N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: Y315N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161070
AA Change: Y243N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: Y243N

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162872
AA Change: Y315N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: Y315N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	T	C	5: 90,593,005		probably null	Het
Aim2	T	A	1: 173,462,115	I208N	possibly damaging	Het
Ank3	A	C	10: 69,991,368		probably benign	Het
Arfgef1	T	C	1: 10,188,811	E687G	possibly damaging	Het
Ash1l	T	A	3: 88,982,761	L649*	probably null	Het
Atp7b	C	T	8: 22,020,820	G437S	probably damaging	Het
BC067074	A	T	13: 113,319,958	N846I	probably damaging	Het
Cep89	G	A	7: 35,420,263	G349D	probably damaging	Het
Csrp2	T	C	10: 110,931,983	C10R	probably damaging	Het
Cux1	T	C	5: 136,311,558	N625D	probably damaging	Het
Dnah9	T	C	11: 65,841,375	N4235S	probably damaging	Het
Dpy19l1	A	G	9: 24,462,600	C265R	probably damaging	Het
Dse	A	G	10: 34,152,340	M918T	probably benign	Het
Duox1	C	A	2: 122,333,807	T916N	possibly damaging	Het
E130308A19Rik	A	T	4: 59,691,332	I389F	probably benign	Het
Eif2ak1	T	A	5: 143,884,799	V311D	probably benign	Het
Eps15	T	A	4: 109,363,198	M534K	probably benign	Het
Gm156	A	G	6: 129,766,695	Y209H	probably benign	Het
Gpr182	A	T	10: 127,751,024	F19L	probably benign	Het
Ifi214	T	A	1: 173,529,417	D40V	probably damaging	Het
Klhl2	A	G	8: 64,811,699	V121A	possibly damaging	Het
Mylk	T	A	16: 34,894,843	S514T	probably benign	Het
Myo18b	C	T	5: 112,865,735	R785H	possibly damaging	Het
Naga	T	G	15: 82,334,856	D230A	possibly damaging	Het
Napsa	A	G	7: 44,581,337	N70D	probably benign	Het
Nup210l	T	A	3: 90,119,909	Y199*	probably null	Het
Olfml2b	A	T	1: 170,649,790	K165*	probably null	Het
Olfr352	C	T	2: 36,870,436	P290L	probably damaging	Het
Paxip1	A	T	5: 27,765,578		probably null	Het
Pcyox1	T	A	6: 86,388,899	K444N	probably benign	Het
Pikfyve	T	A	1: 65,202,925		probably null	Het
Ppp6r3	T	C	19: 3,494,011	I335V	probably benign	Het
Prkcz	A	G	4: 155,356,499	S71P	probably damaging	Het
Psg19	C	T	7: 18,794,089	R243Q	probably benign	Het
Ptbp2	A	T	3: 119,724,120	M382K	possibly damaging	Het
Slc16a14	T	A	1: 84,907,385	I478L	probably benign	Het
Slc45a1	A	T	4: 150,642,639	N174K	probably damaging	Het
Slc5a5	G	A	8: 70,891,178	T160I	probably damaging	Het
Smpdl3b	T	A	4: 132,738,275	H278L	possibly damaging	Het
Sorcs2	C	T	5: 36,062,587	R371H	probably damaging	Het
Synpo2	A	T	3: 123,117,052	S315T	probably damaging	Het
Taok3	A	G	5: 117,204,368	Y137C	probably damaging	Het
Tapbpl	T	C	6: 125,230,716	D49G	probably benign	Het
Tbr1	T	C	2: 61,805,050	S115P	probably benign	Het
Trim67	C	T	8: 124,823,179	T516I	probably benign	Het
Trrap	T	A	5: 144,805,018	L1351Q	probably damaging	Het
Tsc2	A	G	17: 24,596,910	I166T	probably benign	Het
Tspan8	T	A	10: 115,827,824	C22S	probably damaging	Het
Tyro3	T	C	2: 119,816,840	S813P	probably benign	Het
U2af2	G	T	7: 5,075,684	V421L	probably benign	Het
Vmn1r77	T	C	7: 12,041,809	S103P	probably damaging	Het
Vmn2r1	T	A	3: 64,105,452	D911E	probably benign	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Vmn2r56	A	T	7: 12,694,882	C486S	probably damaging	Het
Vwa8	A	G	14: 79,094,332		probably null	Het
Xirp1	T	G	9: 120,018,725	E364A	probably benign	Het
Zbp1	T	C	2: 173,215,841	E99G	probably damaging	Het
Zfp385b	C	A	2: 77,450,268	V109F	possibly damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTGATATTAGTTGGAAAAGGTTG -3'
(R):5'- TCCTCAGAGAGACTATGGTATATCC -3'

Sequencing Primer
(F):5'- TTGGATGGAAGCCCGATGC -3'
(R):5'- GCACTTTTGTCTACTAAGATACCAAC -3'

Posted On

2018-03-15