Incidental Mutation 'R6290:Trim67'
ID508372
Institutional Source Beutler Lab
Gene Symbol Trim67
Ensembl Gene ENSMUSG00000036913
Gene Nametripartite motif-containing 67
SynonymsD130049O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6290 (G1)
Quality Score224.009
Status Not validated
Chromosome8
Chromosomal Location124793092-124834713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124823179 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 516 (T516I)
Ref Sequence ENSEMBL: ENSMUSP00000148625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041106] [ENSMUST00000167588] [ENSMUST00000211867]
Predicted Effect probably benign
Transcript: ENSMUST00000041106
AA Change: T516I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040601
Gene: ENSMUSG00000036913
AA Change: T516I

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 635 755 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167588
AA Change: T516I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130343
Gene: ENSMUSG00000036913
AA Change: T516I

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 633 756 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211867
AA Change: T516I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Trim67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Trim67 APN 8 124815060 splice site probably benign
IGL01676:Trim67 APN 8 124815160 missense possibly damaging 0.51
IGL01779:Trim67 APN 8 124828121 missense probably damaging 1.00
IGL02057:Trim67 APN 8 124823130 missense probably benign 0.00
IGL02201:Trim67 APN 8 124794058 missense probably benign 0.26
IGL02304:Trim67 APN 8 124825952 missense probably damaging 1.00
R0068:Trim67 UTSW 8 124794568 missense probably damaging 0.97
R0241:Trim67 UTSW 8 124823190 missense probably damaging 0.99
R0319:Trim67 UTSW 8 124823227 missense probably damaging 0.98
R0471:Trim67 UTSW 8 124794658 missense probably benign 0.01
R1171:Trim67 UTSW 8 124829081 missense probably damaging 0.97
R1175:Trim67 UTSW 8 124817035 missense probably damaging 0.99
R1444:Trim67 UTSW 8 124823193 missense probably benign 0.01
R1596:Trim67 UTSW 8 124826139 missense probably damaging 0.97
R1706:Trim67 UTSW 8 124794421 missense probably damaging 1.00
R4951:Trim67 UTSW 8 124794667 missense probably benign
R5200:Trim67 UTSW 8 124824850 missense probably damaging 0.99
R5787:Trim67 UTSW 8 124794312 nonsense probably null
R6023:Trim67 UTSW 8 124815104 missense probably damaging 0.99
R6536:Trim67 UTSW 8 124794342 missense possibly damaging 0.51
R7315:Trim67 UTSW 8 124794330 missense probably benign 0.18
R7660:Trim67 UTSW 8 124820285 missense probably damaging 1.00
R8432:Trim67 UTSW 8 124794062 small deletion probably benign
R8446:Trim67 UTSW 8 124793991 missense probably damaging 0.99
R8713:Trim67 UTSW 8 124820335 missense probably null 0.06
Z1088:Trim67 UTSW 8 124817041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATGACTTGGGAGCCAAC -3'
(R):5'- CAAGGTGCTTGTCTTAGGGCAG -3'

Sequencing Primer
(F):5'- AACCCCTGCTCTTGGTGG -3'
(R):5'- TCCTACAGGGTTCTCAGA -3'
Posted On2018-03-15