Incidental Mutation 'R6291:Unc80'
ID508392
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Nameunc-80, NALCN activator
SynonymsC030018G13Rik, C230061B10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R6291 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location66468367-66699148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66521597 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 828 (E828G)
Ref Sequence ENSEMBL: ENSMUSP00000148517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061620
AA Change: E828G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: E828G

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212557
AA Change: E828G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1542 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,566,544 G5D possibly damaging Het
Adamts9 T C 6: 92,890,120 K95R probably damaging Het
Adap1 G T 5: 139,273,491 L314M probably benign Het
Alkbh1 T A 12: 87,429,094 E306V possibly damaging Het
Alpk2 T A 18: 65,305,901 D1274V possibly damaging Het
Ankrd31 A C 13: 96,878,238 K1188N possibly damaging Het
Aox2 T A 1: 58,330,806 M759K probably damaging Het
Atp13a3 T A 16: 30,336,243 D961V probably damaging Het
BC067074 T A 13: 113,320,447 I1009N possibly damaging Het
Bcl11a G A 11: 24,158,321 G100R probably damaging Het
Bpifc G A 10: 85,976,258 A362V probably damaging Het
Btaf1 C T 19: 36,973,008 T546I probably benign Het
Casd1 C A 6: 4,619,834 P193Q probably damaging Het
Cdhr1 T C 14: 37,089,465 T230A probably benign Het
Celsr3 T G 9: 108,828,842 D841E probably damaging Het
Cenpj T C 14: 56,551,976 D872G probably benign Het
Cep95 G T 11: 106,815,596 A559S probably damaging Het
Chpt1 A T 10: 88,475,444 C62* probably null Het
Cspp1 A G 1: 10,064,334 K103R probably damaging Het
Ctla4 T C 1: 60,912,678 V122A probably benign Het
Cyp3a11 A G 5: 145,862,427 F317L possibly damaging Het
Daam1 T C 12: 71,946,251 L338P unknown Het
Dcc T A 18: 71,682,167 I379L probably benign Het
Dennd2c C A 3: 103,131,609 C24* probably null Het
Dnajc12 A G 10: 63,397,274 I65V probably benign Het
Dock3 T A 9: 106,908,432 M208L probably benign Het
Dsg1b T C 18: 20,404,791 I588T possibly damaging Het
Eif1b T C 9: 120,494,140 L22S probably benign Het
Ep300 T A 15: 81,648,507 S1649T unknown Het
Eps15 CAAA CAA 4: 109,305,703 probably null Het
Ercc6 A T 14: 32,569,986 E1102D probably benign Het
Gsdmc3 T C 15: 63,860,241 N312S probably benign Het
Guca2b A T 4: 119,657,693 L57Q probably damaging Het
Heatr5b G T 17: 78,762,097 H1740Q probably benign Het
Hecw1 G A 13: 14,523,007 probably benign Het
Icam5 A G 9: 21,036,921 H675R probably benign Het
Il18rap T C 1: 40,524,889 F56L probably benign Het
Iqgap3 T A 3: 88,089,730 probably null Het
Itsn1 T C 16: 91,868,096 probably benign Het
Jakmip3 A T 7: 139,020,856 D315V probably damaging Het
Kif24 A G 4: 41,413,959 Y328H probably damaging Het
Kmt2a A T 9: 44,832,874 probably benign Het
Kng1 A G 16: 23,079,725 E625G probably damaging Het
Man2b1 C T 8: 85,097,046 T973I probably benign Het
Masp2 G A 4: 148,602,753 V31M probably damaging Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naa15 G A 3: 51,442,791 G103D probably damaging Het
Olfr1029 A G 2: 85,975,582 Y113C probably damaging Het
Olfr1309 A G 2: 111,983,624 V150A probably benign Het
Olfr873 T A 9: 20,300,603 D134E probably damaging Het
Papln A G 12: 83,783,015 N970S probably benign Het
Pick1 T A 15: 79,251,728 probably null Het
Pigr A C 1: 130,841,761 D103A probably benign Het
Plekhf1 A C 7: 38,221,605 F180V possibly damaging Het
Plxnc1 A G 10: 94,833,642 probably null Het
Polr3f A G 2: 144,534,388 I136V probably damaging Het
Ppp2r2c T C 5: 36,940,124 M218T possibly damaging Het
Prox2 C T 12: 85,089,646 V466I probably damaging Het
Prrc2a G A 17: 35,154,933 L1479F probably damaging Het
Rbm24 T A 13: 46,421,837 probably null Het
Rcc1l A T 5: 134,166,721 probably null Het
Ripk4 A C 16: 97,755,123 L140R probably damaging Het
Rmnd1 A T 10: 4,422,135 L188Q probably damaging Het
Rnf170 C T 8: 26,140,964 P249S probably damaging Het
Rras A G 7: 45,018,171 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn7a T A 2: 66,700,114 D629V probably damaging Het
Sipa1l3 A G 7: 29,388,133 S556P probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Snca C T 6: 60,815,718 A69T probably damaging Het
Snx2 T C 18: 53,209,665 probably null Het
Spp1 T A 5: 104,439,376 S109T possibly damaging Het
Stoml3 T C 3: 53,507,516 L243P probably damaging Het
Susd2 A G 10: 75,637,574 F789L possibly damaging Het
Sycp1 A G 3: 102,908,961 M419T probably damaging Het
Thoc1 T C 18: 9,993,330 V563A probably benign Het
Tmprss11g T C 5: 86,487,422 I398V probably damaging Het
Tox3 A G 8: 90,248,938 L355P probably damaging Het
Tpp1 A G 7: 105,747,016 I492T probably benign Het
Trim21 A T 7: 102,564,082 L3Q probably damaging Het
Ttn A C 2: 76,907,736 V4153G probably benign Het
Ttn T C 2: 76,914,294 probably benign Het
Vav3 A G 3: 109,508,854 N263S possibly damaging Het
Vmn1r183 A C 7: 24,055,557 T262P possibly damaging Het
Vmn2r67 G A 7: 85,149,934 P522S possibly damaging Het
Vps35 T A 8: 85,299,457 M1L probably benign Het
Wdr63 G A 3: 146,066,893 S466L probably benign Het
Xpo7 A T 14: 70,704,690 L79* probably null Het
Zc3h14 G A 12: 98,759,828 R324H probably damaging Het
Zfp330 T C 8: 82,772,984 T6A probably damaging Het
Zfp948 T A 17: 21,587,024 H159Q unknown Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 intron probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66503593 missense probably benign 0.00
R7050:Unc80 UTSW 1 66550908 intron probably null
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7278:Unc80 UTSW 1 66552209 missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
R7391:Unc80 UTSW 1 66695528 missense probably benign 0.18
R7401:Unc80 UTSW 1 66646415 missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66622462 missense probably benign 0.02
R7573:Unc80 UTSW 1 66521537 missense probably damaging 1.00
R7637:Unc80 UTSW 1 66672684 missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66649722 missense probably benign 0.33
R7697:Unc80 UTSW 1 66637945 missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66677385 missense probably benign 0.33
R7768:Unc80 UTSW 1 66510595 missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66503714 missense probably benign
R7855:Unc80 UTSW 1 66483349 missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66601141 missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66510707 missense probably benign 0.00
R8024:Unc80 UTSW 1 66606644 missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66483304 missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66648913 missense probably benign 0.00
R8135:Unc80 UTSW 1 66509287 missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66651533 missense probably benign 0.33
R8239:Unc80 UTSW 1 66654019 missense probably benign
R8249:Unc80 UTSW 1 66619491 missense probably benign 0.01
R8275:Unc80 UTSW 1 66640614 nonsense probably null
R8288:Unc80 UTSW 1 66473350 missense probably benign 0.07
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66694409 missense probably benign
Z1177:Unc80 UTSW 1 66646398 missense possibly damaging 0.72
Z1177:Unc80 UTSW 1 66695339 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCAAGGTTAACAGGCGTG -3'
(R):5'- GGCAGAGCAGTTTCCTAAGCTTC -3'

Sequencing Primer
(F):5'- CAAGGTTAACAGGCGTGTCTTTC -3'
(R):5'- AGATGTCTTGAGGGAATCCTATTGC -3'
Posted On2018-03-15