Incidental Mutation 'R6291:Pigr'
ID508393
Institutional Source Beutler Lab
Gene Symbol Pigr
Ensembl Gene ENSMUSG00000026417
Gene Namepolymeric immunoglobulin receptor
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6291 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130826684-130852249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 130841761 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 103 (D103A)
Ref Sequence ENSEMBL: ENSMUSP00000121686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027675] [ENSMUST00000133792] [ENSMUST00000137782]
Predicted Effect probably benign
Transcript: ENSMUST00000027675
AA Change: D103A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027675
Gene: ENSMUSG00000026417
AA Change: D103A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
IG 137 238 8.1e-8 SMART
IG 242 346 1.4e-3 SMART
IG 355 457 3.1e-5 SMART
IG 469 563 1e-10 SMART
IG_like 483 548 8e-3 SMART
low complexity region 627 644 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133792
AA Change: D103A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121686
Gene: ENSMUSG00000026417
AA Change: D103A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
Blast:IG 137 210 3e-47 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137782
AA Change: D103A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114334
Gene: ENSMUSG00000026417
AA Change: D103A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 3.91e-6 SMART
Blast:IG 137 201 4e-40 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily. The encoded poly-Ig receptor binds polymeric immunoglobulin molecules at the basolateral surface of epithelial cells; the complex is then transported across the cell to be secreted at the apical surface. A significant association was found between immunoglobulin A nephropathy and several SNPs in this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Nullizygous mice show impaired transepithelial transport of dimeric IgA, increased serum IgA levels and mucosal leakiness. Studies of one null allele show increased susceptibility to mycobacterial infections while another allele causes impaired clearanceof the protozoan parasite Giardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,566,544 G5D possibly damaging Het
Adamts9 T C 6: 92,890,120 K95R probably damaging Het
Adap1 G T 5: 139,273,491 L314M probably benign Het
Alkbh1 T A 12: 87,429,094 E306V possibly damaging Het
Alpk2 T A 18: 65,305,901 D1274V possibly damaging Het
Ankrd31 A C 13: 96,878,238 K1188N possibly damaging Het
Aox2 T A 1: 58,330,806 M759K probably damaging Het
Atp13a3 T A 16: 30,336,243 D961V probably damaging Het
BC067074 T A 13: 113,320,447 I1009N possibly damaging Het
Bcl11a G A 11: 24,158,321 G100R probably damaging Het
Bpifc G A 10: 85,976,258 A362V probably damaging Het
Btaf1 C T 19: 36,973,008 T546I probably benign Het
Casd1 C A 6: 4,619,834 P193Q probably damaging Het
Cdhr1 T C 14: 37,089,465 T230A probably benign Het
Celsr3 T G 9: 108,828,842 D841E probably damaging Het
Cenpj T C 14: 56,551,976 D872G probably benign Het
Cep95 G T 11: 106,815,596 A559S probably damaging Het
Chpt1 A T 10: 88,475,444 C62* probably null Het
Cspp1 A G 1: 10,064,334 K103R probably damaging Het
Ctla4 T C 1: 60,912,678 V122A probably benign Het
Cyp3a11 A G 5: 145,862,427 F317L possibly damaging Het
Daam1 T C 12: 71,946,251 L338P unknown Het
Dcc T A 18: 71,682,167 I379L probably benign Het
Dennd2c C A 3: 103,131,609 C24* probably null Het
Dnajc12 A G 10: 63,397,274 I65V probably benign Het
Dock3 T A 9: 106,908,432 M208L probably benign Het
Dsg1b T C 18: 20,404,791 I588T possibly damaging Het
Eif1b T C 9: 120,494,140 L22S probably benign Het
Ep300 T A 15: 81,648,507 S1649T unknown Het
Eps15 CAAA CAA 4: 109,305,703 probably null Het
Ercc6 A T 14: 32,569,986 E1102D probably benign Het
Gsdmc3 T C 15: 63,860,241 N312S probably benign Het
Guca2b A T 4: 119,657,693 L57Q probably damaging Het
Heatr5b G T 17: 78,762,097 H1740Q probably benign Het
Hecw1 G A 13: 14,523,007 probably benign Het
Icam5 A G 9: 21,036,921 H675R probably benign Het
Il18rap T C 1: 40,524,889 F56L probably benign Het
Iqgap3 T A 3: 88,089,730 probably null Het
Itsn1 T C 16: 91,868,096 probably benign Het
Jakmip3 A T 7: 139,020,856 D315V probably damaging Het
Kif24 A G 4: 41,413,959 Y328H probably damaging Het
Kmt2a A T 9: 44,832,874 probably benign Het
Kng1 A G 16: 23,079,725 E625G probably damaging Het
Man2b1 C T 8: 85,097,046 T973I probably benign Het
Masp2 G A 4: 148,602,753 V31M probably damaging Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naa15 G A 3: 51,442,791 G103D probably damaging Het
Olfr1029 A G 2: 85,975,582 Y113C probably damaging Het
Olfr1309 A G 2: 111,983,624 V150A probably benign Het
Olfr873 T A 9: 20,300,603 D134E probably damaging Het
Papln A G 12: 83,783,015 N970S probably benign Het
Pick1 T A 15: 79,251,728 probably null Het
Plekhf1 A C 7: 38,221,605 F180V possibly damaging Het
Plxnc1 A G 10: 94,833,642 probably null Het
Polr3f A G 2: 144,534,388 I136V probably damaging Het
Ppp2r2c T C 5: 36,940,124 M218T possibly damaging Het
Prox2 C T 12: 85,089,646 V466I probably damaging Het
Prrc2a G A 17: 35,154,933 L1479F probably damaging Het
Rbm24 T A 13: 46,421,837 probably null Het
Rcc1l A T 5: 134,166,721 probably null Het
Ripk4 A C 16: 97,755,123 L140R probably damaging Het
Rmnd1 A T 10: 4,422,135 L188Q probably damaging Het
Rnf170 C T 8: 26,140,964 P249S probably damaging Het
Rras A G 7: 45,018,171 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn7a T A 2: 66,700,114 D629V probably damaging Het
Sipa1l3 A G 7: 29,388,133 S556P probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Snca C T 6: 60,815,718 A69T probably damaging Het
Snx2 T C 18: 53,209,665 probably null Het
Spp1 T A 5: 104,439,376 S109T possibly damaging Het
Stoml3 T C 3: 53,507,516 L243P probably damaging Het
Susd2 A G 10: 75,637,574 F789L possibly damaging Het
Sycp1 A G 3: 102,908,961 M419T probably damaging Het
Thoc1 T C 18: 9,993,330 V563A probably benign Het
Tmprss11g T C 5: 86,487,422 I398V probably damaging Het
Tox3 A G 8: 90,248,938 L355P probably damaging Het
Tpp1 A G 7: 105,747,016 I492T probably benign Het
Trim21 A T 7: 102,564,082 L3Q probably damaging Het
Ttn A C 2: 76,907,736 V4153G probably benign Het
Ttn T C 2: 76,914,294 probably benign Het
Unc80 A G 1: 66,521,597 E828G possibly damaging Het
Vav3 A G 3: 109,508,854 N263S possibly damaging Het
Vmn1r183 A C 7: 24,055,557 T262P possibly damaging Het
Vmn2r67 G A 7: 85,149,934 P522S possibly damaging Het
Vps35 T A 8: 85,299,457 M1L probably benign Het
Wdr63 G A 3: 146,066,893 S466L probably benign Het
Xpo7 A T 14: 70,704,690 L79* probably null Het
Zc3h14 G A 12: 98,759,828 R324H probably damaging Het
Zfp330 T C 8: 82,772,984 T6A probably damaging Het
Zfp948 T A 17: 21,587,024 H159Q unknown Het
Other mutations in Pigr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pigr APN 1 130834430 start codon destroyed probably null 1.00
IGL01565:Pigr APN 1 130844474 missense possibly damaging 0.93
IGL01592:Pigr APN 1 130849058 missense probably damaging 1.00
IGL02153:Pigr APN 1 130849056 unclassified probably null
IGL02508:Pigr APN 1 130850858 missense probably benign 0.02
IGL02815:Pigr APN 1 130841821 missense probably damaging 1.00
R0834:Pigr UTSW 1 130844544 nonsense probably null
R1453:Pigr UTSW 1 130841544 missense probably benign 0.00
R1728:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1729:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1730:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1736:Pigr UTSW 1 130841803 missense possibly damaging 0.92
R1739:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1742:Pigr UTSW 1 130845086 missense probably damaging 1.00
R1762:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1783:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1784:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1785:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1929:Pigr UTSW 1 130846662 unclassified probably benign
R2065:Pigr UTSW 1 130850880 missense probably benign 0.20
R2275:Pigr UTSW 1 130846470 missense probably benign 0.00
R2513:Pigr UTSW 1 130846620 missense possibly damaging 0.71
R2910:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2911:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2964:Pigr UTSW 1 130841535 missense probably damaging 1.00
R3857:Pigr UTSW 1 130847261 missense probably benign 0.06
R4165:Pigr UTSW 1 130841817 missense probably benign 0.26
R4166:Pigr UTSW 1 130841817 missense probably benign 0.26
R4303:Pigr UTSW 1 130841817 missense probably benign 0.26
R4735:Pigr UTSW 1 130846554 missense probably damaging 0.99
R4909:Pigr UTSW 1 130848458 missense possibly damaging 0.77
R4993:Pigr UTSW 1 130841817 missense probably benign 0.26
R4994:Pigr UTSW 1 130841817 missense probably benign 0.26
R5033:Pigr UTSW 1 130844699 missense probably damaging 1.00
R5116:Pigr UTSW 1 130849031 missense probably benign 0.00
R5304:Pigr UTSW 1 130849493 missense probably benign 0.00
R5440:Pigr UTSW 1 130849622 splice site probably null
R5853:Pigr UTSW 1 130846604 nonsense probably null
R5934:Pigr UTSW 1 130844527 missense probably damaging 0.98
R6015:Pigr UTSW 1 130847261 missense probably benign 0.06
R6749:Pigr UTSW 1 130846548 missense probably benign 0.14
R6941:Pigr UTSW 1 130847327 missense probably damaging 1.00
R7369:Pigr UTSW 1 130841766 missense probably benign 0.00
R7391:Pigr UTSW 1 130849566 missense probably damaging 1.00
R7564:Pigr UTSW 1 130841666 missense possibly damaging 0.67
R7760:Pigr UTSW 1 130846631 missense possibly damaging 0.59
R7995:Pigr UTSW 1 130841686 missense probably damaging 1.00
R8094:Pigr UTSW 1 130846510 missense probably damaging 1.00
R8096:Pigr UTSW 1 130846510 missense probably damaging 1.00
Z1176:Pigr UTSW 1 130850815 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGCGACTCTGTTTCCATCAC -3'
(R):5'- TTCATGTCAAGAAACCCTTCTGTAG -3'

Sequencing Primer
(F):5'- GTGCTACTACCCAGACACCTCTG -3'
(R):5'- TCTGTAGGAGGTATCTGCCCC -3'
Posted On2018-03-15