Incidental Mutation 'R6291:Ppp2r2c'
ID508411
Institutional Source Beutler Lab
Gene Symbol Ppp2r2c
Ensembl Gene ENSMUSG00000029120
Gene Nameprotein phosphatase 2, regulatory subunit B, gamma
Synonyms6330548O06Rik, IMYPNO1, PR52
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R6291 (G1)
Quality Score189.009
Status Validated
Chromosome5
Chromosomal Location36868513-36955078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36940124 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 218 (M218T)
Ref Sequence ENSEMBL: ENSMUSP00000031003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031003]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031003
AA Change: M218T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031003
Gene: ENSMUSG00000029120
AA Change: M218T

DomainStartEndE-ValueType
WD40 13 52 1.99e0 SMART
WD40 79 119 2.38e1 SMART
WD40 161 200 1.11e0 SMART
WD40 211 251 5.7e1 SMART
WD40 270 308 4.11e1 SMART
Blast:WD40 312 366 1e-24 BLAST
WD40 402 439 3.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138124
Meta Mutation Damage Score 0.9125 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,566,544 G5D possibly damaging Het
Adamts9 T C 6: 92,890,120 K95R probably damaging Het
Adap1 G T 5: 139,273,491 L314M probably benign Het
Alkbh1 T A 12: 87,429,094 E306V possibly damaging Het
Alpk2 T A 18: 65,305,901 D1274V possibly damaging Het
Ankrd31 A C 13: 96,878,238 K1188N possibly damaging Het
Aox2 T A 1: 58,330,806 M759K probably damaging Het
Atp13a3 T A 16: 30,336,243 D961V probably damaging Het
BC067074 T A 13: 113,320,447 I1009N possibly damaging Het
Bcl11a G A 11: 24,158,321 G100R probably damaging Het
Bpifc G A 10: 85,976,258 A362V probably damaging Het
Btaf1 C T 19: 36,973,008 T546I probably benign Het
Casd1 C A 6: 4,619,834 P193Q probably damaging Het
Cdhr1 T C 14: 37,089,465 T230A probably benign Het
Celsr3 T G 9: 108,828,842 D841E probably damaging Het
Cenpj T C 14: 56,551,976 D872G probably benign Het
Cep95 G T 11: 106,815,596 A559S probably damaging Het
Chpt1 A T 10: 88,475,444 C62* probably null Het
Cspp1 A G 1: 10,064,334 K103R probably damaging Het
Ctla4 T C 1: 60,912,678 V122A probably benign Het
Cyp3a11 A G 5: 145,862,427 F317L possibly damaging Het
Daam1 T C 12: 71,946,251 L338P unknown Het
Dcc T A 18: 71,682,167 I379L probably benign Het
Dennd2c C A 3: 103,131,609 C24* probably null Het
Dnajc12 A G 10: 63,397,274 I65V probably benign Het
Dock3 T A 9: 106,908,432 M208L probably benign Het
Dsg1b T C 18: 20,404,791 I588T possibly damaging Het
Eif1b T C 9: 120,494,140 L22S probably benign Het
Ep300 T A 15: 81,648,507 S1649T unknown Het
Eps15 CAAA CAA 4: 109,305,703 probably null Het
Ercc6 A T 14: 32,569,986 E1102D probably benign Het
Gsdmc3 T C 15: 63,860,241 N312S probably benign Het
Guca2b A T 4: 119,657,693 L57Q probably damaging Het
Heatr5b G T 17: 78,762,097 H1740Q probably benign Het
Hecw1 G A 13: 14,523,007 probably benign Het
Icam5 A G 9: 21,036,921 H675R probably benign Het
Il18rap T C 1: 40,524,889 F56L probably benign Het
Iqgap3 T A 3: 88,089,730 probably null Het
Itsn1 T C 16: 91,868,096 probably benign Het
Jakmip3 A T 7: 139,020,856 D315V probably damaging Het
Kif24 A G 4: 41,413,959 Y328H probably damaging Het
Kmt2a A T 9: 44,832,874 probably benign Het
Kng1 A G 16: 23,079,725 E625G probably damaging Het
Man2b1 C T 8: 85,097,046 T973I probably benign Het
Masp2 G A 4: 148,602,753 V31M probably damaging Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naa15 G A 3: 51,442,791 G103D probably damaging Het
Olfr1029 A G 2: 85,975,582 Y113C probably damaging Het
Olfr1309 A G 2: 111,983,624 V150A probably benign Het
Olfr873 T A 9: 20,300,603 D134E probably damaging Het
Papln A G 12: 83,783,015 N970S probably benign Het
Pick1 T A 15: 79,251,728 probably null Het
Pigr A C 1: 130,841,761 D103A probably benign Het
Plekhf1 A C 7: 38,221,605 F180V possibly damaging Het
Plxnc1 A G 10: 94,833,642 probably null Het
Polr3f A G 2: 144,534,388 I136V probably damaging Het
Prox2 C T 12: 85,089,646 V466I probably damaging Het
Prrc2a G A 17: 35,154,933 L1479F probably damaging Het
Rbm24 T A 13: 46,421,837 probably null Het
Rcc1l A T 5: 134,166,721 probably null Het
Ripk4 A C 16: 97,755,123 L140R probably damaging Het
Rmnd1 A T 10: 4,422,135 L188Q probably damaging Het
Rnf170 C T 8: 26,140,964 P249S probably damaging Het
Rras A G 7: 45,018,171 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn7a T A 2: 66,700,114 D629V probably damaging Het
Sipa1l3 A G 7: 29,388,133 S556P probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Snca C T 6: 60,815,718 A69T probably damaging Het
Snx2 T C 18: 53,209,665 probably null Het
Spp1 T A 5: 104,439,376 S109T possibly damaging Het
Stoml3 T C 3: 53,507,516 L243P probably damaging Het
Susd2 A G 10: 75,637,574 F789L possibly damaging Het
Sycp1 A G 3: 102,908,961 M419T probably damaging Het
Thoc1 T C 18: 9,993,330 V563A probably benign Het
Tmprss11g T C 5: 86,487,422 I398V probably damaging Het
Tox3 A G 8: 90,248,938 L355P probably damaging Het
Tpp1 A G 7: 105,747,016 I492T probably benign Het
Trim21 A T 7: 102,564,082 L3Q probably damaging Het
Ttn A C 2: 76,907,736 V4153G probably benign Het
Ttn T C 2: 76,914,294 probably benign Het
Unc80 A G 1: 66,521,597 E828G possibly damaging Het
Vav3 A G 3: 109,508,854 N263S possibly damaging Het
Vmn1r183 A C 7: 24,055,557 T262P possibly damaging Het
Vmn2r67 G A 7: 85,149,934 P522S possibly damaging Het
Vps35 T A 8: 85,299,457 M1L probably benign Het
Wdr63 G A 3: 146,066,893 S466L probably benign Het
Xpo7 A T 14: 70,704,690 L79* probably null Het
Zc3h14 G A 12: 98,759,828 R324H probably damaging Het
Zfp330 T C 8: 82,772,984 T6A probably damaging Het
Zfp948 T A 17: 21,587,024 H159Q unknown Het
Other mutations in Ppp2r2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Ppp2r2c APN 5 36947121 missense possibly damaging 0.82
IGL01583:Ppp2r2c APN 5 36868822 start codon destroyed probably null 0.99
IGL01662:Ppp2r2c APN 5 36926400 missense probably damaging 1.00
IGL01674:Ppp2r2c APN 5 36940226 missense possibly damaging 0.63
IGL02027:Ppp2r2c APN 5 36952472 missense probably damaging 0.99
IGL03118:Ppp2r2c APN 5 36926316 missense probably damaging 1.00
R0034:Ppp2r2c UTSW 5 36927539 missense probably benign 0.02
R2036:Ppp2r2c UTSW 5 36952404 missense possibly damaging 0.84
R4877:Ppp2r2c UTSW 5 36868870 missense probably damaging 0.98
R4980:Ppp2r2c UTSW 5 36952388 missense probably benign 0.01
R5838:Ppp2r2c UTSW 5 36940187 missense probably benign 0.14
R6940:Ppp2r2c UTSW 5 36927531 missense probably damaging 0.98
R7405:Ppp2r2c UTSW 5 36947142 missense possibly damaging 0.71
R7695:Ppp2r2c UTSW 5 36947182 missense probably damaging 1.00
R7967:Ppp2r2c UTSW 5 36940106 missense possibly damaging 0.88
R8307:Ppp2r2c UTSW 5 36947086 missense probably damaging 1.00
X0013:Ppp2r2c UTSW 5 36926325 missense probably damaging 1.00
Z1176:Ppp2r2c UTSW 5 36931277 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTTCCATGTGAATCTGGCTGG -3'
(R):5'- ATGTGCCACAGTAGTGCACC -3'

Sequencing Primer
(F):5'- GGGACTAGGGACTGGGGTG -3'
(R):5'- GTGCACCCACTTGCCAGTC -3'
Posted On2018-03-15