Incidental Mutation 'R6291:Tox3'
ID508435
Institutional Source Beutler Lab
Gene Symbol Tox3
Ensembl Gene ENSMUSG00000043668
Gene NameTOX high mobility group box family member 3
SynonymsCAGF9, Tnrc9, 500-9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R6291 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location90247040-90348343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90248938 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 355 (L355P)
Ref Sequence ENSEMBL: ENSMUSP00000105250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109621] [ENSMUST00000176616]
Predicted Effect probably damaging
Transcript: ENSMUST00000109621
AA Change: L355P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105250
Gene: ENSMUSG00000043668
AA Change: L355P

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
HMG 253 323 2.93e-19 SMART
low complexity region 345 362 N/A INTRINSIC
coiled coil region 438 466 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176616
SMART Domains Protein: ENSMUSP00000135697
Gene: ENSMUSG00000043668

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 194 213 N/A INTRINSIC
HMG 252 309 1.29e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an HMG-box, indicating that it may be involved in bending and unwinding of DNA and alteration of chromatin structure. The C-terminus of the encoded protein is glutamine-rich due to CAG repeats in the coding sequence. A minor allele of this gene has been implicated in an elevated risk of breast cancer. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,566,544 G5D possibly damaging Het
Adamts9 T C 6: 92,890,120 K95R probably damaging Het
Adap1 G T 5: 139,273,491 L314M probably benign Het
Alkbh1 T A 12: 87,429,094 E306V possibly damaging Het
Alpk2 T A 18: 65,305,901 D1274V possibly damaging Het
Ankrd31 A C 13: 96,878,238 K1188N possibly damaging Het
Aox2 T A 1: 58,330,806 M759K probably damaging Het
Atp13a3 T A 16: 30,336,243 D961V probably damaging Het
BC067074 T A 13: 113,320,447 I1009N possibly damaging Het
Bcl11a G A 11: 24,158,321 G100R probably damaging Het
Bpifc G A 10: 85,976,258 A362V probably damaging Het
Btaf1 C T 19: 36,973,008 T546I probably benign Het
Casd1 C A 6: 4,619,834 P193Q probably damaging Het
Cdhr1 T C 14: 37,089,465 T230A probably benign Het
Celsr3 T G 9: 108,828,842 D841E probably damaging Het
Cenpj T C 14: 56,551,976 D872G probably benign Het
Cep95 G T 11: 106,815,596 A559S probably damaging Het
Chpt1 A T 10: 88,475,444 C62* probably null Het
Cspp1 A G 1: 10,064,334 K103R probably damaging Het
Ctla4 T C 1: 60,912,678 V122A probably benign Het
Cyp3a11 A G 5: 145,862,427 F317L possibly damaging Het
Daam1 T C 12: 71,946,251 L338P unknown Het
Dcc T A 18: 71,682,167 I379L probably benign Het
Dennd2c C A 3: 103,131,609 C24* probably null Het
Dnajc12 A G 10: 63,397,274 I65V probably benign Het
Dock3 T A 9: 106,908,432 M208L probably benign Het
Dsg1b T C 18: 20,404,791 I588T possibly damaging Het
Eif1b T C 9: 120,494,140 L22S probably benign Het
Ep300 T A 15: 81,648,507 S1649T unknown Het
Eps15 CAAA CAA 4: 109,305,703 probably null Het
Ercc6 A T 14: 32,569,986 E1102D probably benign Het
Gsdmc3 T C 15: 63,860,241 N312S probably benign Het
Guca2b A T 4: 119,657,693 L57Q probably damaging Het
Heatr5b G T 17: 78,762,097 H1740Q probably benign Het
Hecw1 G A 13: 14,523,007 probably benign Het
Icam5 A G 9: 21,036,921 H675R probably benign Het
Il18rap T C 1: 40,524,889 F56L probably benign Het
Iqgap3 T A 3: 88,089,730 probably null Het
Itsn1 T C 16: 91,868,096 probably benign Het
Jakmip3 A T 7: 139,020,856 D315V probably damaging Het
Kif24 A G 4: 41,413,959 Y328H probably damaging Het
Kmt2a A T 9: 44,832,874 probably benign Het
Kng1 A G 16: 23,079,725 E625G probably damaging Het
Man2b1 C T 8: 85,097,046 T973I probably benign Het
Masp2 G A 4: 148,602,753 V31M probably damaging Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naa15 G A 3: 51,442,791 G103D probably damaging Het
Olfr1029 A G 2: 85,975,582 Y113C probably damaging Het
Olfr1309 A G 2: 111,983,624 V150A probably benign Het
Olfr873 T A 9: 20,300,603 D134E probably damaging Het
Papln A G 12: 83,783,015 N970S probably benign Het
Pick1 T A 15: 79,251,728 probably null Het
Pigr A C 1: 130,841,761 D103A probably benign Het
Plekhf1 A C 7: 38,221,605 F180V possibly damaging Het
Plxnc1 A G 10: 94,833,642 probably null Het
Polr3f A G 2: 144,534,388 I136V probably damaging Het
Ppp2r2c T C 5: 36,940,124 M218T possibly damaging Het
Prox2 C T 12: 85,089,646 V466I probably damaging Het
Prrc2a G A 17: 35,154,933 L1479F probably damaging Het
Rbm24 T A 13: 46,421,837 probably null Het
Rcc1l A T 5: 134,166,721 probably null Het
Ripk4 A C 16: 97,755,123 L140R probably damaging Het
Rmnd1 A T 10: 4,422,135 L188Q probably damaging Het
Rnf170 C T 8: 26,140,964 P249S probably damaging Het
Rras A G 7: 45,018,171 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn7a T A 2: 66,700,114 D629V probably damaging Het
Sipa1l3 A G 7: 29,388,133 S556P probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Snca C T 6: 60,815,718 A69T probably damaging Het
Snx2 T C 18: 53,209,665 probably null Het
Spp1 T A 5: 104,439,376 S109T possibly damaging Het
Stoml3 T C 3: 53,507,516 L243P probably damaging Het
Susd2 A G 10: 75,637,574 F789L possibly damaging Het
Sycp1 A G 3: 102,908,961 M419T probably damaging Het
Thoc1 T C 18: 9,993,330 V563A probably benign Het
Tmprss11g T C 5: 86,487,422 I398V probably damaging Het
Tpp1 A G 7: 105,747,016 I492T probably benign Het
Trim21 A T 7: 102,564,082 L3Q probably damaging Het
Ttn A C 2: 76,907,736 V4153G probably benign Het
Ttn T C 2: 76,914,294 probably benign Het
Unc80 A G 1: 66,521,597 E828G possibly damaging Het
Vav3 A G 3: 109,508,854 N263S possibly damaging Het
Vmn1r183 A C 7: 24,055,557 T262P possibly damaging Het
Vmn2r67 G A 7: 85,149,934 P522S possibly damaging Het
Vps35 T A 8: 85,299,457 M1L probably benign Het
Wdr63 G A 3: 146,066,893 S466L probably benign Het
Xpo7 A T 14: 70,704,690 L79* probably null Het
Zc3h14 G A 12: 98,759,828 R324H probably damaging Het
Zfp330 T C 8: 82,772,984 T6A probably damaging Het
Zfp948 T A 17: 21,587,024 H159Q unknown Het
Other mutations in Tox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Tox3 APN 8 90270434 missense probably damaging 1.00
IGL02417:Tox3 APN 8 90258131 missense possibly damaging 0.52
IGL02447:Tox3 APN 8 90258153 splice site probably benign
R1139:Tox3 UTSW 8 90248869 missense probably damaging 1.00
R1472:Tox3 UTSW 8 90254345 missense probably damaging 1.00
R1892:Tox3 UTSW 8 90270241 missense probably benign 0.31
R1906:Tox3 UTSW 8 90248429 unclassified probably benign
R2847:Tox3 UTSW 8 90248390 nonsense probably null
R2849:Tox3 UTSW 8 90248390 nonsense probably null
R3703:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R3705:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R4984:Tox3 UTSW 8 90248642 unclassified probably benign
R5249:Tox3 UTSW 8 90248816 missense probably benign 0.09
R5722:Tox3 UTSW 8 90347861 critical splice donor site probably null
R6451:Tox3 UTSW 8 90258059 missense probably benign 0.31
R7653:Tox3 UTSW 8 90248989 missense probably damaging 1.00
R7753:Tox3 UTSW 8 90248932 missense probably damaging 1.00
R8220:Tox3 UTSW 8 90258080 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCGTCCCCATGGAACTTATC -3'
(R):5'- TTTCGACAGTCCTATGGCAAAG -3'

Sequencing Primer
(F):5'- TCCCCATGGAACTTATCAGTGGAG -3'
(R):5'- GCAAAGGCCTTGGAGATGG -3'
Posted On2018-03-15