Incidental Mutation 'R6291:Daam1'
ID 508450
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Name dishevelled associated activator of morphogenesis 1
Synonyms 1700066F09Rik, 2310028E21Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6291 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 71831078-71992333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71946251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 338 (L338P)
Ref Sequence ENSEMBL: ENSMUSP00000152564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
AlphaFold Q8BPM0
Predicted Effect unknown
Transcript: ENSMUST00000085299
AA Change: L338P
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: L338P

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221317
AA Change: L338P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222327
Predicted Effect unknown
Transcript: ENSMUST00000223272
AA Change: L338P
Meta Mutation Damage Score 0.1518 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,566,544 G5D possibly damaging Het
Adamts9 T C 6: 92,890,120 K95R probably damaging Het
Adap1 G T 5: 139,273,491 L314M probably benign Het
Alkbh1 T A 12: 87,429,094 E306V possibly damaging Het
Alpk2 T A 18: 65,305,901 D1274V possibly damaging Het
Ankrd31 A C 13: 96,878,238 K1188N possibly damaging Het
Aox2 T A 1: 58,330,806 M759K probably damaging Het
Atp13a3 T A 16: 30,336,243 D961V probably damaging Het
BC067074 T A 13: 113,320,447 I1009N possibly damaging Het
Bcl11a G A 11: 24,158,321 G100R probably damaging Het
Bpifc G A 10: 85,976,258 A362V probably damaging Het
Btaf1 C T 19: 36,973,008 T546I probably benign Het
Casd1 C A 6: 4,619,834 P193Q probably damaging Het
Cdhr1 T C 14: 37,089,465 T230A probably benign Het
Celsr3 T G 9: 108,828,842 D841E probably damaging Het
Cenpj T C 14: 56,551,976 D872G probably benign Het
Cep95 G T 11: 106,815,596 A559S probably damaging Het
Chpt1 A T 10: 88,475,444 C62* probably null Het
Cspp1 A G 1: 10,064,334 K103R probably damaging Het
Ctla4 T C 1: 60,912,678 V122A probably benign Het
Cyp3a11 A G 5: 145,862,427 F317L possibly damaging Het
Dcc T A 18: 71,682,167 I379L probably benign Het
Dennd2c C A 3: 103,131,609 C24* probably null Het
Dnajc12 A G 10: 63,397,274 I65V probably benign Het
Dock3 T A 9: 106,908,432 M208L probably benign Het
Dsg1b T C 18: 20,404,791 I588T possibly damaging Het
Eif1b T C 9: 120,494,140 L22S probably benign Het
Ep300 T A 15: 81,648,507 S1649T unknown Het
Eps15 CAAA CAA 4: 109,305,703 probably null Het
Ercc6 A T 14: 32,569,986 E1102D probably benign Het
Gsdmc3 T C 15: 63,860,241 N312S probably benign Het
Guca2b A T 4: 119,657,693 L57Q probably damaging Het
Heatr5b G T 17: 78,762,097 H1740Q probably benign Het
Hecw1 G A 13: 14,523,007 probably benign Het
Icam5 A G 9: 21,036,921 H675R probably benign Het
Il18rap T C 1: 40,524,889 F56L probably benign Het
Iqgap3 T A 3: 88,089,730 probably null Het
Itsn1 T C 16: 91,868,096 probably benign Het
Jakmip3 A T 7: 139,020,856 D315V probably damaging Het
Kif24 A G 4: 41,413,959 Y328H probably damaging Het
Kmt2a A T 9: 44,832,874 probably benign Het
Kng1 A G 16: 23,079,725 E625G probably damaging Het
Man2b1 C T 8: 85,097,046 T973I probably benign Het
Masp2 G A 4: 148,602,753 V31M probably damaging Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naa15 G A 3: 51,442,791 G103D probably damaging Het
Olfr1029 A G 2: 85,975,582 Y113C probably damaging Het
Olfr1309 A G 2: 111,983,624 V150A probably benign Het
Olfr873 T A 9: 20,300,603 D134E probably damaging Het
Papln A G 12: 83,783,015 N970S probably benign Het
Pick1 T A 15: 79,251,728 probably null Het
Pigr A C 1: 130,841,761 D103A probably benign Het
Plekhf1 A C 7: 38,221,605 F180V possibly damaging Het
Plxnc1 A G 10: 94,833,642 probably null Het
Polr3f A G 2: 144,534,388 I136V probably damaging Het
Ppp2r2c T C 5: 36,940,124 M218T possibly damaging Het
Prox2 C T 12: 85,089,646 V466I probably damaging Het
Prrc2a G A 17: 35,154,933 L1479F probably damaging Het
Rbm24 T A 13: 46,421,837 probably null Het
Rcc1l A T 5: 134,166,721 probably null Het
Ripk4 A C 16: 97,755,123 L140R probably damaging Het
Rmnd1 A T 10: 4,422,135 L188Q probably damaging Het
Rnf170 C T 8: 26,140,964 P249S probably damaging Het
Rras A G 7: 45,018,171 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn7a T A 2: 66,700,114 D629V probably damaging Het
Sipa1l3 A G 7: 29,388,133 S556P probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Snca C T 6: 60,815,718 A69T probably damaging Het
Snx2 T C 18: 53,209,665 probably null Het
Spp1 T A 5: 104,439,376 S109T possibly damaging Het
Stoml3 T C 3: 53,507,516 L243P probably damaging Het
Susd2 A G 10: 75,637,574 F789L possibly damaging Het
Sycp1 A G 3: 102,908,961 M419T probably damaging Het
Thoc1 T C 18: 9,993,330 V563A probably benign Het
Tmprss11g T C 5: 86,487,422 I398V probably damaging Het
Tox3 A G 8: 90,248,938 L355P probably damaging Het
Tpp1 A G 7: 105,747,016 I492T probably benign Het
Trim21 A T 7: 102,564,082 L3Q probably damaging Het
Ttn A C 2: 76,907,736 V4153G probably benign Het
Ttn T C 2: 76,914,294 probably benign Het
Unc80 A G 1: 66,521,597 E828G possibly damaging Het
Vav3 A G 3: 109,508,854 N263S possibly damaging Het
Vmn1r183 A C 7: 24,055,557 T262P possibly damaging Het
Vmn2r67 G A 7: 85,149,934 P522S possibly damaging Het
Vps35 T A 8: 85,299,457 M1L probably benign Het
Wdr63 G A 3: 146,066,893 S466L probably benign Het
Xpo7 A T 14: 70,704,690 L79* probably null Het
Zc3h14 G A 12: 98,759,828 R324H probably damaging Het
Zfp330 T C 8: 82,772,984 T6A probably damaging Het
Zfp948 T A 17: 21,587,024 H159Q unknown Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
R8157:Daam1 UTSW 12 71952489 missense probably damaging 1.00
R8187:Daam1 UTSW 12 71895828 missense unknown
R8297:Daam1 UTSW 12 71951915 missense unknown
R8963:Daam1 UTSW 12 71945244 missense unknown
R9283:Daam1 UTSW 12 71988922 missense probably damaging 1.00
R9402:Daam1 UTSW 12 71959830 missense probably benign 0.09
R9563:Daam1 UTSW 12 71945477 missense unknown
R9696:Daam1 UTSW 12 71944373 missense unknown
R9762:Daam1 UTSW 12 71944081 missense unknown
R9803:Daam1 UTSW 12 71944148 missense unknown
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGAGGCAGGCACTCACTG -3'
(R):5'- CTGCCATCTAGGTAACAGAGCAG -3'

Sequencing Primer
(F):5'- ACTGTGCCCCTAGCCTG -3'
(R):5'- AGCAGGATGTTGACTTAGCTCAC -3'
Posted On 2018-03-15