Mutagenetix > Incidental Mutations

Incidental Mutation 'R6292:Apip'

508482

Institutional Source

Beutler Lab

Gene Symbol

Apip

Ensembl Gene

ENSMUSG00000010911

Gene Name

APAF1 interacting protein

Synonyms

CGI-29, APIP2, Mmrp19

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103073675-103092644 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 103092467 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 210 (C210F)

Ref Sequence

ENSEMBL: ENSMUSP00000011055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011055]

Predicted Effect

probably benign
Transcript: ENSMUST00000011055
AA Change: C210F

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000011055
Gene: ENSMUSG00000010911
AA Change: C210F

Domain	Start	End	E-Value	Type
Aldolase_II	25	221	1.64e-47	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147131

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155004

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] APIP is an APAF1 (MIM 602233)-interacting protein that acts as a negative regulator of ischemic/hypoxic injury (Cho et al., 2004 [PubMed 15262985]).[supplied by OMIM, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,200,251	V709E	probably damaging	Het
Ankrd33b	C	T	15: 31,325,085		probably null	Het
Apaf1	T	C	10: 90,991,563	T1202A	possibly damaging	Het
Chd9	A	T	8: 90,932,922	H170L	probably benign	Het
Clec16a	T	C	16: 10,560,151		probably null	Het
Ep300	T	A	15: 81,616,734		probably benign	Het
Etl4	C	T	2: 20,743,573	H39Y	probably damaging	Het
Gdap1l1	A	T	2: 163,451,507	I218F	probably damaging	Het
Gm5141	A	T	13: 62,774,438	C306S	probably damaging	Het
Gm9961	C	T	16: 11,930,472		noncoding transcript	Het
Gpr27	C	T	6: 99,693,658	S327L	possibly damaging	Het
Hectd3	A	C	4: 116,998,808	T435P	probably damaging	Het
Hs3st1	T	A	5: 39,614,790	Q170L	possibly damaging	Het
Hykk	T	C	9: 54,920,826		probably null	Het
Lilra5	T	C	7: 4,238,339	S92P	possibly damaging	Het
Lrig1	A	T	6: 94,616,445	N418K	probably damaging	Het
Miga1	A	G	3: 152,317,719	F232L	probably benign	Het
Mkrn2	T	A	6: 115,613,334	M217K	probably damaging	Het
Myh7b	A	T	2: 155,632,396	Q1677L	probably damaging	Het
N4bp1	T	C	8: 86,853,239	E645G	probably damaging	Het
Nckap5	T	C	1: 125,915,015	K1752E	probably damaging	Het
Nek1	A	G	8: 61,054,736		probably null	Het
Ntng1	T	C	3: 110,143,886		probably benign	Het
Nup133	A	G	8: 123,917,437	V730A	probably benign	Het
Olfr314	T	A	11: 58,786,237	M1K	probably null	Het
Olfr620	T	A	7: 103,612,179	H58L	probably damaging	Het
Paqr6	C	T	3: 88,367,898	P213S	probably damaging	Het
Pign	A	T	1: 105,585,077	V627D	possibly damaging	Het
Rasal1	T	A	5: 120,659,620	V139E	probably damaging	Het
Scgb1b24	G	T	7: 33,744,152	A79S	possibly damaging	Het
Slc25a28	T	C	19: 43,664,592	D210G	probably benign	Het
Slc38a3	A	T	9: 107,655,154	I393N	possibly damaging	Het
Slc41a2	T	C	10: 83,254,926	N465D	probably damaging	Het
Slc5a5	G	A	8: 70,891,178	T160I	probably damaging	Het
Smarca2	C	T	19: 26,630,892	A117V	probably damaging	Het
Sorcs2	C	T	5: 36,062,587	R371H	probably damaging	Het
Taf4	A	G	2: 179,923,987	S872P	probably damaging	Het
Tdrd3	G	T	14: 87,506,254	C540F	probably benign	Het
Thumpd1	A	T	7: 119,720,674	L23Q	probably benign	Het
Top1	A	T	2: 160,698,141	Y213F	probably benign	Het
Txndc5	T	C	13: 38,528,184		probably null	Het
Unc79	C	A	12: 103,142,732	A2005D	possibly damaging	Het
Upb1	T	C	10: 75,438,171	L344P	probably damaging	Het
Vmn1r72	T	A	7: 11,669,652	S290C	probably benign	Het
Vmn2r103	A	G	17: 19,793,604	I219M	possibly damaging	Het
Wapl	A	G	14: 34,729,195	T729A	probably damaging	Het
Washc5	C	T	15: 59,355,934	R393H	probably damaging	Het

Other mutations in Apip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Apip	APN	2	103091912	missense	probably benign	0.02
IGL01631:Apip	APN	2	103073849	unclassified	probably benign
IGL01736:Apip	APN	2	103087141	missense	probably damaging	0.98
IGL02734:Apip	APN	2	103089544	splice site	probably benign
BB006:Apip	UTSW	2	103083021	missense	probably benign	0.00
BB016:Apip	UTSW	2	103083021	missense	probably benign	0.00
R0256:Apip	UTSW	2	103088571	missense	possibly damaging	0.68
R1518:Apip	UTSW	2	103089493	missense	probably damaging	1.00
R1829:Apip	UTSW	2	103088662	missense	probably benign	0.09
R4930:Apip	UTSW	2	103091881	nonsense	probably null
R6300:Apip	UTSW	2	103087153	missense	possibly damaging	0.92
R6725:Apip	UTSW	2	103092525	missense	possibly damaging	0.79
R6759:Apip	UTSW	2	103091846	missense	probably benign	0.02
R6843:Apip	UTSW	2	103092489	missense	probably benign	0.14
R6968:Apip	UTSW	2	103089453	missense	possibly damaging	0.94
R7168:Apip	UTSW	2	103092468	nonsense	probably null
R7494:Apip	UTSW	2	103092551	missense	probably benign	0.00
R7929:Apip	UTSW	2	103083021	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCCTTGCAGGTTTGAAAATTG -3'
(R):5'- ACCATCGGTAGTATTCTGTGACAG -3'

Sequencing Primer
(F):5'- GGTTTGAAAATTGTTGGGGTCAAAAC -3'
(R):5'- CTGTGACAGATTAGTGACATCAAG -3'

Posted On

2018-03-15