Incidental Mutation 'R6292:Myh7b'
ID508483
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6292 (G1)
Quality Score204.009
Status Validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155632396 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1677 (Q1677L)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000092995] [ENSMUST00000103140]
Predicted Effect probably benign
Transcript: ENSMUST00000041059
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: Q1677L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: Q1677L

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103140
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154656
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7711:Myh7b UTSW 2 155620403 missense probably damaging 1.00
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTACTCCATTCCTGTGGG -3'
(R):5'- AACATCTTTGGCGCATCCCC -3'

Sequencing Primer
(F):5'- CTCCCTGGATGCAGAGACAAG -3'
(R):5'- TCCCCCACCTGCGAATG -3'
Posted On2018-03-15