Mutagenetix > Incidental Mutation

Incidental Mutation 'R6292:Top1'

508484

Institutional Source

Beutler Lab

Gene Symbol

Top1

Ensembl Gene

ENSMUSG00000070544

Gene Name

topoisomerase (DNA) I

Synonyms

D130064I21Rik, Top-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160645888-160722764 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 160698141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 213 (Y213F)

Ref Sequence

ENSEMBL: ENSMUSP00000105094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109468]

AlphaFold

Q04750

Predicted Effect

probably benign
Transcript: ENSMUST00000109468
AA Change: Y213F

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: Y213F

Domain	Start	End	E-Value	Type
low complexity region	20	95	N/A	INTRINSIC
low complexity region	150	211	N/A	INTRINSIC
Blast:TOPEUc	245	321	9e-19	BLAST
low complexity region	323	339	N/A	INTRINSIC
TOPEUc	362	739	4.43e-280	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164694

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,200,251	V709E	probably damaging	Het
Ankrd33b	C	T	15: 31,325,085		probably null	Het
Apaf1	T	C	10: 90,991,563	T1202A	possibly damaging	Het
Apip	G	T	2: 103,092,467	C210F	probably benign	Het
Chd9	A	T	8: 90,932,922	H170L	probably benign	Het
Clec16a	T	C	16: 10,560,151		probably null	Het
Ep300	T	A	15: 81,616,734		probably benign	Het
Etl4	C	T	2: 20,743,573	H39Y	probably damaging	Het
Gdap1l1	A	T	2: 163,451,507	I218F	probably damaging	Het
Gm5141	A	T	13: 62,774,438	C306S	probably damaging	Het
Gm9961	C	T	16: 11,930,472		noncoding transcript	Het
Gpr27	C	T	6: 99,693,658	S327L	possibly damaging	Het
Hectd3	A	C	4: 116,998,808	T435P	probably damaging	Het
Hs3st1	T	A	5: 39,614,790	Q170L	possibly damaging	Het
Hykk	T	C	9: 54,920,826		probably null	Het
Lilra5	T	C	7: 4,238,339	S92P	possibly damaging	Het
Lrig1	A	T	6: 94,616,445	N418K	probably damaging	Het
Miga1	A	G	3: 152,317,719	F232L	probably benign	Het
Mkrn2	T	A	6: 115,613,334	M217K	probably damaging	Het
Myh7b	A	T	2: 155,632,396	Q1677L	probably damaging	Het
N4bp1	T	C	8: 86,853,239	E645G	probably damaging	Het
Nckap5	T	C	1: 125,915,015	K1752E	probably damaging	Het
Nek1	A	G	8: 61,054,736		probably null	Het
Ntng1	T	C	3: 110,143,886		probably benign	Het
Nup133	A	G	8: 123,917,437	V730A	probably benign	Het
Olfr314	T	A	11: 58,786,237	M1K	probably null	Het
Olfr620	T	A	7: 103,612,179	H58L	probably damaging	Het
Paqr6	C	T	3: 88,367,898	P213S	probably damaging	Het
Pign	A	T	1: 105,585,077	V627D	possibly damaging	Het
Rasal1	T	A	5: 120,659,620	V139E	probably damaging	Het
Scgb1b24	G	T	7: 33,744,152	A79S	possibly damaging	Het
Slc25a28	T	C	19: 43,664,592	D210G	probably benign	Het
Slc38a3	A	T	9: 107,655,154	I393N	possibly damaging	Het
Slc41a2	T	C	10: 83,254,926	N465D	probably damaging	Het
Slc5a5	G	A	8: 70,891,178	T160I	probably damaging	Het
Smarca2	C	T	19: 26,630,892	A117V	probably damaging	Het
Sorcs2	C	T	5: 36,062,587	R371H	probably damaging	Het
Taf4	A	G	2: 179,923,987	S872P	probably damaging	Het
Tdrd3	G	T	14: 87,506,254	C540F	probably benign	Het
Thumpd1	A	T	7: 119,720,674	L23Q	probably benign	Het
Txndc5	T	C	13: 38,528,184		probably null	Het
Unc79	C	A	12: 103,142,732	A2005D	possibly damaging	Het
Upb1	T	C	10: 75,438,171	L344P	probably damaging	Het
Vmn1r72	T	A	7: 11,669,652	S290C	probably benign	Het
Vmn2r103	A	G	17: 19,793,604	I219M	possibly damaging	Het
Wapl	A	G	14: 34,729,195	T729A	probably damaging	Het
Washc5	C	T	15: 59,355,934	R393H	probably damaging	Het

Other mutations in Top1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02168:Top1	APN	2	160704973	splice site	probably null
IGL03083:Top1	APN	2	160703578	missense	probably damaging	0.97
IGL03242:Top1	APN	2	160715733	missense	probably damaging	1.00
IGL03369:Top1	APN	2	160693727	missense	unknown
Mainspring	UTSW	2	160714238	missense	probably damaging	0.98
taut	UTSW	2	160721001	missense	probably damaging	0.99
unwind	UTSW	2	160704819	missense	probably damaging	1.00
R0022:Top1	UTSW	2	160702799	missense	possibly damaging	0.62
R0449:Top1	UTSW	2	160712708	nonsense	probably null
R0501:Top1	UTSW	2	160714159	missense	probably damaging	1.00
R0564:Top1	UTSW	2	160714265	missense	probably damaging	0.98
R0946:Top1	UTSW	2	160712668	nonsense	probably null
R0972:Top1	UTSW	2	160721025	missense	probably damaging	1.00
R0976:Top1	UTSW	2	160717423	missense	possibly damaging	0.86
R1534:Top1	UTSW	2	160714232	missense	probably damaging	1.00
R1608:Top1	UTSW	2	160703595	missense	probably benign	0.01
R1655:Top1	UTSW	2	160703696	critical splice donor site	probably null
R1818:Top1	UTSW	2	160715723	missense	probably damaging	1.00
R1937:Top1	UTSW	2	160670122	missense	unknown
R2055:Top1	UTSW	2	160702828	splice site	probably benign
R2104:Top1	UTSW	2	160704819	missense	probably damaging	1.00
R3705:Top1	UTSW	2	160702824	critical splice donor site	probably null
R3769:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3770:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3801:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3804:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3928:Top1	UTSW	2	160687749	splice site	probably benign
R4598:Top1	UTSW	2	160720965	missense	possibly damaging	0.89
R4651:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4652:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4742:Top1	UTSW	2	160703570	critical splice acceptor site	probably null
R5523:Top1	UTSW	2	160702775	nonsense	probably null
R6724:Top1	UTSW	2	160712696	missense	probably damaging	1.00
R7354:Top1	UTSW	2	160704958	missense	probably damaging	1.00
R7461:Top1	UTSW	2	160712842	splice site	probably null
R7843:Top1	UTSW	2	160714256	missense	possibly damaging	0.90
R7855:Top1	UTSW	2	160714088	missense	probably damaging	1.00
R8100:Top1	UTSW	2	160698235	nonsense	probably null
R8302:Top1	UTSW	2	160703576	missense	probably damaging	1.00
R8377:Top1	UTSW	2	160646089	start gained	probably benign
R8380:Top1	UTSW	2	160717395	missense	probably benign	0.00
R8381:Top1	UTSW	2	160703674	missense	probably null	0.77
R8392:Top1	UTSW	2	160717454	nonsense	probably null
R8713:Top1	UTSW	2	160717440	missense	probably damaging	0.98
R8773:Top1	UTSW	2	160714238	missense	probably damaging	0.98
R8844:Top1	UTSW	2	160721549	missense	probably damaging	1.00
R8949:Top1	UTSW	2	160705262	missense	possibly damaging	0.77
R8992:Top1	UTSW	2	160721001	missense	probably damaging	0.99
R9133:Top1	UTSW	2	160703671	nonsense	probably null
R9799:Top1	UTSW	2	160721486	missense	probably damaging	1.00
X0027:Top1	UTSW	2	160721518	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGTTTGCTTGAAATTGCTGCTC -3'
(R):5'- ATTCCTTTTCCCAAGCCACACATAG -3'

Sequencing Primer
(F):5'- GCTGCTCTTTTCAGTGAGACACAG -3'
(R):5'- CTAGCTAGGACTGTGCAATATAGGC -3'

Posted On

2018-03-15