Incidental Mutation 'R6292:Gdap1l1'
ID508485
Institutional Source Beutler Lab
Gene Symbol Gdap1l1
Ensembl Gene ENSMUSG00000017943
Gene Nameganglioside-induced differentiation-associated protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R6292 (G1)
Quality Score128.008
Status Validated
Chromosome2
Chromosomal Location163438476-163455324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 163451507 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 218 (I218F)
Ref Sequence ENSEMBL: ENSMUSP00000105047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018087] [ENSMUST00000109420] [ENSMUST00000109421] [ENSMUST00000137070]
Predicted Effect probably damaging
Transcript: ENSMUST00000018087
AA Change: I218F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018087
Gene: ENSMUSG00000017943
AA Change: I218F

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109420
AA Change: I218F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105047
Gene: ENSMUSG00000017943
AA Change: I218F

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109421
AA Change: I221F

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105048
Gene: ENSMUSG00000017943
AA Change: I221F

DomainStartEndE-ValueType
Pfam:GST_N 45 123 1.2e-8 PFAM
Pfam:GST_N_3 49 129 3.3e-10 PFAM
Pfam:GST_N_2 62 124 7.6e-9 PFAM
Pfam:GST_C_2 182 307 8.2e-9 PFAM
Pfam:GST_C 201 311 3.4e-8 PFAM
transmembrane domain 343 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137070
AA Change: I160F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119421
Gene: ENSMUSG00000017943
AA Change: I160F

DomainStartEndE-ValueType
Pfam:GST_N 45 120 2.3e-8 PFAM
Pfam:GST_N_3 49 126 1.6e-13 PFAM
Pfam:GST_N_2 55 121 1.1e-9 PFAM
Pfam:GST_C_2 142 246 3.1e-8 PFAM
Pfam:GST_C 146 251 1.6e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Gdap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Gdap1l1 APN 2 163453668 missense probably damaging 1.00
IGL02171:Gdap1l1 APN 2 163447550 missense possibly damaging 0.78
IGL02335:Gdap1l1 APN 2 163447595 missense possibly damaging 0.50
F5770:Gdap1l1 UTSW 2 163447486 intron probably benign
R0091:Gdap1l1 UTSW 2 163446091 missense probably damaging 1.00
R0165:Gdap1l1 UTSW 2 163451499 critical splice acceptor site probably null
R0242:Gdap1l1 UTSW 2 163447653 nonsense probably null
R1577:Gdap1l1 UTSW 2 163438604 missense probably damaging 0.96
R2022:Gdap1l1 UTSW 2 163447597 missense probably benign 0.04
R4960:Gdap1l1 UTSW 2 163453859 missense probably benign 0.00
R6027:Gdap1l1 UTSW 2 163451611 missense possibly damaging 0.57
R6678:Gdap1l1 UTSW 2 163438654 missense probably benign
R7034:Gdap1l1 UTSW 2 163446145 missense probably damaging 1.00
R7173:Gdap1l1 UTSW 2 163438688 missense probably damaging 0.99
R7195:Gdap1l1 UTSW 2 163446130 missense probably damaging 1.00
Z1176:Gdap1l1 UTSW 2 163447670 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCGTGTCACATACAGGAG -3'
(R):5'- TGTCTCTGGGAGAAAGAGGC -3'

Sequencing Primer
(F):5'- TCACATACAGGAGGGGGTATTTG -3'
(R):5'- GCTGGGGATTGACAGAGTG -3'
Posted On2018-03-15