Incidental Mutation 'R6292:Gdap1l1'
ID 508485
Institutional Source Beutler Lab
Gene Symbol Gdap1l1
Ensembl Gene ENSMUSG00000017943
Gene Name ganglioside-induced differentiation-associated protein 1-like 1
Synonyms
MMRRC Submission 044461-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R6292 (G1)
Quality Score 128.008
Status Validated
Chromosome 2
Chromosomal Location 163280396-163297244 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 163293427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 218 (I218F)
Ref Sequence ENSEMBL: ENSMUSP00000105047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018087] [ENSMUST00000109420] [ENSMUST00000109421] [ENSMUST00000137070]
AlphaFold Q8VE33
Predicted Effect probably damaging
Transcript: ENSMUST00000018087
AA Change: I218F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018087
Gene: ENSMUSG00000017943
AA Change: I218F

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109420
AA Change: I218F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105047
Gene: ENSMUSG00000017943
AA Change: I218F

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109421
AA Change: I221F

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105048
Gene: ENSMUSG00000017943
AA Change: I221F

DomainStartEndE-ValueType
Pfam:GST_N 45 123 1.2e-8 PFAM
Pfam:GST_N_3 49 129 3.3e-10 PFAM
Pfam:GST_N_2 62 124 7.6e-9 PFAM
Pfam:GST_C_2 182 307 8.2e-9 PFAM
Pfam:GST_C 201 311 3.4e-8 PFAM
transmembrane domain 343 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137070
AA Change: I160F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119421
Gene: ENSMUSG00000017943
AA Change: I160F

DomainStartEndE-ValueType
Pfam:GST_N 45 120 2.3e-8 PFAM
Pfam:GST_N_3 49 126 1.6e-13 PFAM
Pfam:GST_N_2 55 121 1.1e-9 PFAM
Pfam:GST_C_2 142 246 3.1e-8 PFAM
Pfam:GST_C 146 251 1.6e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,338,312 (GRCm39) V709E probably damaging Het
Ankrd33b C T 15: 31,325,231 (GRCm39) probably null Het
Apaf1 T C 10: 90,827,425 (GRCm39) T1202A possibly damaging Het
Apip G T 2: 102,922,812 (GRCm39) C210F probably benign Het
Chd9 A T 8: 91,659,550 (GRCm39) H170L probably benign Het
Clec16a T C 16: 10,378,015 (GRCm39) probably null Het
Ep300 T A 15: 81,500,935 (GRCm39) probably benign Het
Etl4 C T 2: 20,748,384 (GRCm39) H39Y probably damaging Het
Gm5141 A T 13: 62,922,252 (GRCm39) C306S probably damaging Het
Gm9961 C T 16: 11,748,336 (GRCm39) noncoding transcript Het
Gpr27 C T 6: 99,670,619 (GRCm39) S327L possibly damaging Het
Hectd3 A C 4: 116,856,005 (GRCm39) T435P probably damaging Het
Hs3st1 T A 5: 39,772,133 (GRCm39) Q170L possibly damaging Het
Hykk T C 9: 54,828,110 (GRCm39) probably null Het
Lilra5 T C 7: 4,241,338 (GRCm39) S92P possibly damaging Het
Lrig1 A T 6: 94,593,426 (GRCm39) N418K probably damaging Het
Miga1 A G 3: 152,023,356 (GRCm39) F232L probably benign Het
Mkrn2 T A 6: 115,590,295 (GRCm39) M217K probably damaging Het
Myh7b A T 2: 155,474,316 (GRCm39) Q1677L probably damaging Het
N4bp1 T C 8: 87,579,867 (GRCm39) E645G probably damaging Het
Nckap5 T C 1: 125,842,752 (GRCm39) K1752E probably damaging Het
Nek1 A G 8: 61,507,770 (GRCm39) probably null Het
Ntng1 T C 3: 110,051,202 (GRCm39) probably benign Het
Nup133 A G 8: 124,644,176 (GRCm39) V730A probably benign Het
Or2t44 T A 11: 58,677,063 (GRCm39) M1K probably null Het
Or51v14 T A 7: 103,261,386 (GRCm39) H58L probably damaging Het
Paqr6 C T 3: 88,275,205 (GRCm39) P213S probably damaging Het
Pign A T 1: 105,512,802 (GRCm39) V627D possibly damaging Het
Rasal1 T A 5: 120,797,685 (GRCm39) V139E probably damaging Het
Scgb1b24 G T 7: 33,443,577 (GRCm39) A79S possibly damaging Het
Slc25a28 T C 19: 43,653,031 (GRCm39) D210G probably benign Het
Slc38a3 A T 9: 107,532,353 (GRCm39) I393N possibly damaging Het
Slc41a2 T C 10: 83,090,790 (GRCm39) N465D probably damaging Het
Slc5a5 G A 8: 71,343,822 (GRCm39) T160I probably damaging Het
Smarca2 C T 19: 26,608,292 (GRCm39) A117V probably damaging Het
Sorcs2 C T 5: 36,219,931 (GRCm39) R371H probably damaging Het
Taf4 A G 2: 179,565,780 (GRCm39) S872P probably damaging Het
Tdrd3 G T 14: 87,743,690 (GRCm39) C540F probably benign Het
Thumpd1 A T 7: 119,319,897 (GRCm39) L23Q probably benign Het
Top1 A T 2: 160,540,061 (GRCm39) Y213F probably benign Het
Txndc5 T C 13: 38,712,160 (GRCm39) probably null Het
Unc79 C A 12: 103,108,991 (GRCm39) A2005D possibly damaging Het
Upb1 T C 10: 75,274,005 (GRCm39) L344P probably damaging Het
Vmn1r72 T A 7: 11,403,579 (GRCm39) S290C probably benign Het
Vmn2r103 A G 17: 20,013,866 (GRCm39) I219M possibly damaging Het
Wapl A G 14: 34,451,152 (GRCm39) T729A probably damaging Het
Washc5 C T 15: 59,227,783 (GRCm39) R393H probably damaging Het
Other mutations in Gdap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Gdap1l1 APN 2 163,295,588 (GRCm39) missense probably damaging 1.00
IGL02171:Gdap1l1 APN 2 163,289,470 (GRCm39) missense possibly damaging 0.78
IGL02335:Gdap1l1 APN 2 163,289,515 (GRCm39) missense possibly damaging 0.50
F5770:Gdap1l1 UTSW 2 163,289,406 (GRCm39) intron probably benign
R0091:Gdap1l1 UTSW 2 163,288,011 (GRCm39) missense probably damaging 1.00
R0165:Gdap1l1 UTSW 2 163,293,419 (GRCm39) critical splice acceptor site probably null
R0242:Gdap1l1 UTSW 2 163,289,573 (GRCm39) nonsense probably null
R1577:Gdap1l1 UTSW 2 163,280,524 (GRCm39) missense probably damaging 0.96
R2022:Gdap1l1 UTSW 2 163,289,517 (GRCm39) missense probably benign 0.04
R4960:Gdap1l1 UTSW 2 163,295,779 (GRCm39) missense probably benign 0.00
R6027:Gdap1l1 UTSW 2 163,293,531 (GRCm39) missense possibly damaging 0.57
R6678:Gdap1l1 UTSW 2 163,280,574 (GRCm39) missense probably benign
R7034:Gdap1l1 UTSW 2 163,288,065 (GRCm39) missense probably damaging 1.00
R7173:Gdap1l1 UTSW 2 163,280,608 (GRCm39) missense probably damaging 0.99
R7195:Gdap1l1 UTSW 2 163,288,050 (GRCm39) missense probably damaging 1.00
R9085:Gdap1l1 UTSW 2 163,280,508 (GRCm39) missense probably damaging 0.99
R9331:Gdap1l1 UTSW 2 163,295,664 (GRCm39) missense probably benign 0.00
Z1176:Gdap1l1 UTSW 2 163,289,590 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCGTGTCACATACAGGAG -3'
(R):5'- TGTCTCTGGGAGAAAGAGGC -3'

Sequencing Primer
(F):5'- TCACATACAGGAGGGGGTATTTG -3'
(R):5'- GCTGGGGATTGACAGAGTG -3'
Posted On 2018-03-15