Mutagenetix > Incidental Mutation

Incidental Mutation 'R6292:Hectd3'

508489

Institutional Source

Beutler Lab

Gene Symbol

Hectd3

Ensembl Gene

ENSMUSG00000046861

Gene Name

HECT domain E3 ubiquitin protein ligase 3

Synonyms

1700064K09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116995317-117005277 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 116998808 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 435 (T435P)

Ref Sequence

ENSEMBL: ENSMUSP00000051922 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030446] [ENSMUST00000050067] [ENSMUST00000130273]

AlphaFold

Q3U487

Predicted Effect

probably benign
Transcript: ENSMUST00000030446

SMART Domains

Protein: ENSMUSP00000030446
Gene: ENSMUSG00000028684

Domain	Start	End	E-Value	Type
Pfam:URO-D	14	360	2.4e-135	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000050067
AA Change: T435P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: T435P

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	68	81	N/A	INTRINSIC
APC10	237	391	6.75e-23	SMART
HECTc	514	857	1.27e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123079

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127635

Predicted Effect

probably benign
Transcript: ENSMUST00000130273

SMART Domains

Protein: ENSMUSP00000116154
Gene: ENSMUSG00000028684

Domain	Start	End	E-Value	Type
Pfam:URO-D	1	64	1.2e-18	PFAM
Pfam:URO-D	60	120	4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133234

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135164

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138729

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139209

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139816

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155267

Meta Mutation Damage Score

0.3155

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,200,251	V709E	probably damaging	Het
Ankrd33b	C	T	15: 31,325,085		probably null	Het
Apaf1	T	C	10: 90,991,563	T1202A	possibly damaging	Het
Apip	G	T	2: 103,092,467	C210F	probably benign	Het
Chd9	A	T	8: 90,932,922	H170L	probably benign	Het
Clec16a	T	C	16: 10,560,151		probably null	Het
Ep300	T	A	15: 81,616,734		probably benign	Het
Etl4	C	T	2: 20,743,573	H39Y	probably damaging	Het
Gdap1l1	A	T	2: 163,451,507	I218F	probably damaging	Het
Gm5141	A	T	13: 62,774,438	C306S	probably damaging	Het
Gm9961	C	T	16: 11,930,472		noncoding transcript	Het
Gpr27	C	T	6: 99,693,658	S327L	possibly damaging	Het
Hs3st1	T	A	5: 39,614,790	Q170L	possibly damaging	Het
Hykk	T	C	9: 54,920,826		probably null	Het
Lilra5	T	C	7: 4,238,339	S92P	possibly damaging	Het
Lrig1	A	T	6: 94,616,445	N418K	probably damaging	Het
Miga1	A	G	3: 152,317,719	F232L	probably benign	Het
Mkrn2	T	A	6: 115,613,334	M217K	probably damaging	Het
Myh7b	A	T	2: 155,632,396	Q1677L	probably damaging	Het
N4bp1	T	C	8: 86,853,239	E645G	probably damaging	Het
Nckap5	T	C	1: 125,915,015	K1752E	probably damaging	Het
Nek1	A	G	8: 61,054,736		probably null	Het
Ntng1	T	C	3: 110,143,886		probably benign	Het
Nup133	A	G	8: 123,917,437	V730A	probably benign	Het
Olfr314	T	A	11: 58,786,237	M1K	probably null	Het
Olfr620	T	A	7: 103,612,179	H58L	probably damaging	Het
Paqr6	C	T	3: 88,367,898	P213S	probably damaging	Het
Pign	A	T	1: 105,585,077	V627D	possibly damaging	Het
Rasal1	T	A	5: 120,659,620	V139E	probably damaging	Het
Scgb1b24	G	T	7: 33,744,152	A79S	possibly damaging	Het
Slc25a28	T	C	19: 43,664,592	D210G	probably benign	Het
Slc38a3	A	T	9: 107,655,154	I393N	possibly damaging	Het
Slc41a2	T	C	10: 83,254,926	N465D	probably damaging	Het
Slc5a5	G	A	8: 70,891,178	T160I	probably damaging	Het
Smarca2	C	T	19: 26,630,892	A117V	probably damaging	Het
Sorcs2	C	T	5: 36,062,587	R371H	probably damaging	Het
Taf4	A	G	2: 179,923,987	S872P	probably damaging	Het
Tdrd3	G	T	14: 87,506,254	C540F	probably benign	Het
Thumpd1	A	T	7: 119,720,674	L23Q	probably benign	Het
Top1	A	T	2: 160,698,141	Y213F	probably benign	Het
Txndc5	T	C	13: 38,528,184		probably null	Het
Unc79	C	A	12: 103,142,732	A2005D	possibly damaging	Het
Upb1	T	C	10: 75,438,171	L344P	probably damaging	Het
Vmn1r72	T	A	7: 11,669,652	S290C	probably benign	Het
Vmn2r103	A	G	17: 19,793,604	I219M	possibly damaging	Het
Wapl	A	G	14: 34,729,195	T729A	probably damaging	Het
Washc5	C	T	15: 59,355,934	R393H	probably damaging	Het

Other mutations in Hectd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Hectd3	APN	4	117000588	splice site	probably benign
IGL00227:Hectd3	APN	4	117000587	splice site	probably benign
IGL00227:Hectd3	APN	4	117000589	splice site	probably benign
IGL00987:Hectd3	APN	4	116999643	missense	probably damaging	0.98
IGL01402:Hectd3	APN	4	116996065	missense	probably damaging	0.96
IGL01660:Hectd3	APN	4	116996372	missense	possibly damaging	0.91
IGL02397:Hectd3	APN	4	117003136	missense	possibly damaging	0.94
IGL03029:Hectd3	APN	4	116996965	nonsense	probably null
chopstix2	UTSW	4	116996396	missense	probably benign	0.08
R0147:Hectd3	UTSW	4	116997040	unclassified	probably benign
R0240:Hectd3	UTSW	4	117002613	missense	probably damaging	0.97
R0240:Hectd3	UTSW	4	117002613	missense	probably damaging	0.97
R0611:Hectd3	UTSW	4	116996044	missense	possibly damaging	0.67
R1367:Hectd3	UTSW	4	116997170	missense	probably null	0.48
R1401:Hectd3	UTSW	4	117002269	missense	possibly damaging	0.52
R1444:Hectd3	UTSW	4	116996396	missense	probably benign	0.08
R1466:Hectd3	UTSW	4	116996566	missense	probably damaging	0.98
R1466:Hectd3	UTSW	4	116996566	missense	probably damaging	0.98
R1517:Hectd3	UTSW	4	117002994	missense	probably damaging	0.96
R1584:Hectd3	UTSW	4	116996566	missense	probably damaging	0.98
R1593:Hectd3	UTSW	4	116997020	missense	possibly damaging	0.86
R1628:Hectd3	UTSW	4	116997392	missense	probably damaging	1.00
R1669:Hectd3	UTSW	4	116999643	missense	probably damaging	0.98
R1731:Hectd3	UTSW	4	116996455	critical splice donor site	probably null
R1918:Hectd3	UTSW	4	117000343	missense	possibly damaging	0.68
R2029:Hectd3	UTSW	4	117000685	missense	probably damaging	0.99
R2174:Hectd3	UTSW	4	116999701	missense	probably benign	0.04
R2184:Hectd3	UTSW	4	117000903	missense	possibly damaging	0.93
R2226:Hectd3	UTSW	4	116995689	missense	possibly damaging	0.67
R3721:Hectd3	UTSW	4	116999745	missense	probably benign	0.08
R3895:Hectd3	UTSW	4	116996089	missense	probably damaging	1.00
R3937:Hectd3	UTSW	4	116998530	missense	probably benign	0.28
R4291:Hectd3	UTSW	4	116995692	missense	probably damaging	1.00
R4729:Hectd3	UTSW	4	116997218	missense	probably damaging	0.98
R4837:Hectd3	UTSW	4	117002597	missense	probably null	0.32
R5059:Hectd3	UTSW	4	116997164	missense	possibly damaging	0.93
R5090:Hectd3	UTSW	4	117000238	splice site	probably benign
R5910:Hectd3	UTSW	4	117002134	missense	probably benign	0.09
R5932:Hectd3	UTSW	4	117002273	missense	possibly damaging	0.79
R6182:Hectd3	UTSW	4	117000279	missense	probably damaging	1.00
R6405:Hectd3	UTSW	4	117000624	missense	probably benign	0.04
R6478:Hectd3	UTSW	4	116999586	missense	probably damaging	1.00
R7444:Hectd3	UTSW	4	116996927	missense	possibly damaging	0.48
R7471:Hectd3	UTSW	4	116996588	missense	probably benign	0.01
R8053:Hectd3	UTSW	4	117000858	missense	possibly damaging	0.65
R8671:Hectd3	UTSW	4	116996581	missense	possibly damaging	0.67
R8840:Hectd3	UTSW	4	116998407	missense	probably benign	0.14
R9520:Hectd3	UTSW	4	117000685	missense	probably damaging	0.99
R9746:Hectd3	UTSW	4	116995754	missense	probably damaging	1.00
Z1177:Hectd3	UTSW	4	116998760	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTATTCTGCTTCGAGGGCCAG -3'
(R):5'- CCTTTGTCATGTGGAGCTCG -3'

Sequencing Primer
(F):5'- AGAGCACCTCCTGAGCCTC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'

Posted On

2018-03-15