Incidental Mutation 'R6292:Sorcs2'
ID 508490
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 044461-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6292 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36219931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 371 (R371H)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000135324]
AlphaFold Q9EPR5
Predicted Effect probably damaging
Transcript: ENSMUST00000037370
AA Change: R371H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: R371H

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135324
SMART Domains Protein: ENSMUSP00000123543
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
SCOP:d1eur__ 1 111 2e-3 SMART
Blast:VPS10 1 173 1e-126 BLAST
PDB:4N7E|A 6 117 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137040
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,338,312 (GRCm39) V709E probably damaging Het
Ankrd33b C T 15: 31,325,231 (GRCm39) probably null Het
Apaf1 T C 10: 90,827,425 (GRCm39) T1202A possibly damaging Het
Apip G T 2: 102,922,812 (GRCm39) C210F probably benign Het
Chd9 A T 8: 91,659,550 (GRCm39) H170L probably benign Het
Clec16a T C 16: 10,378,015 (GRCm39) probably null Het
Ep300 T A 15: 81,500,935 (GRCm39) probably benign Het
Etl4 C T 2: 20,748,384 (GRCm39) H39Y probably damaging Het
Gdap1l1 A T 2: 163,293,427 (GRCm39) I218F probably damaging Het
Gm5141 A T 13: 62,922,252 (GRCm39) C306S probably damaging Het
Gm9961 C T 16: 11,748,336 (GRCm39) noncoding transcript Het
Gpr27 C T 6: 99,670,619 (GRCm39) S327L possibly damaging Het
Hectd3 A C 4: 116,856,005 (GRCm39) T435P probably damaging Het
Hs3st1 T A 5: 39,772,133 (GRCm39) Q170L possibly damaging Het
Hykk T C 9: 54,828,110 (GRCm39) probably null Het
Lilra5 T C 7: 4,241,338 (GRCm39) S92P possibly damaging Het
Lrig1 A T 6: 94,593,426 (GRCm39) N418K probably damaging Het
Miga1 A G 3: 152,023,356 (GRCm39) F232L probably benign Het
Mkrn2 T A 6: 115,590,295 (GRCm39) M217K probably damaging Het
Myh7b A T 2: 155,474,316 (GRCm39) Q1677L probably damaging Het
N4bp1 T C 8: 87,579,867 (GRCm39) E645G probably damaging Het
Nckap5 T C 1: 125,842,752 (GRCm39) K1752E probably damaging Het
Nek1 A G 8: 61,507,770 (GRCm39) probably null Het
Ntng1 T C 3: 110,051,202 (GRCm39) probably benign Het
Nup133 A G 8: 124,644,176 (GRCm39) V730A probably benign Het
Or2t44 T A 11: 58,677,063 (GRCm39) M1K probably null Het
Or51v14 T A 7: 103,261,386 (GRCm39) H58L probably damaging Het
Paqr6 C T 3: 88,275,205 (GRCm39) P213S probably damaging Het
Pign A T 1: 105,512,802 (GRCm39) V627D possibly damaging Het
Rasal1 T A 5: 120,797,685 (GRCm39) V139E probably damaging Het
Scgb1b24 G T 7: 33,443,577 (GRCm39) A79S possibly damaging Het
Slc25a28 T C 19: 43,653,031 (GRCm39) D210G probably benign Het
Slc38a3 A T 9: 107,532,353 (GRCm39) I393N possibly damaging Het
Slc41a2 T C 10: 83,090,790 (GRCm39) N465D probably damaging Het
Slc5a5 G A 8: 71,343,822 (GRCm39) T160I probably damaging Het
Smarca2 C T 19: 26,608,292 (GRCm39) A117V probably damaging Het
Taf4 A G 2: 179,565,780 (GRCm39) S872P probably damaging Het
Tdrd3 G T 14: 87,743,690 (GRCm39) C540F probably benign Het
Thumpd1 A T 7: 119,319,897 (GRCm39) L23Q probably benign Het
Top1 A T 2: 160,540,061 (GRCm39) Y213F probably benign Het
Txndc5 T C 13: 38,712,160 (GRCm39) probably null Het
Unc79 C A 12: 103,108,991 (GRCm39) A2005D possibly damaging Het
Upb1 T C 10: 75,274,005 (GRCm39) L344P probably damaging Het
Vmn1r72 T A 7: 11,403,579 (GRCm39) S290C probably benign Het
Vmn2r103 A G 17: 20,013,866 (GRCm39) I219M possibly damaging Het
Wapl A G 14: 34,451,152 (GRCm39) T729A probably damaging Het
Washc5 C T 15: 59,227,783 (GRCm39) R393H probably damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGGTTCTTTGCACATGCTC -3'
(R):5'- TCTTAGGTGACTCTGAATCTGAC -3'

Sequencing Primer
(F):5'- CACTTTATTATAATAGGCTGGCAGGG -3'
(R):5'- GTGACTCTGAATCTGACAAGAGCTAC -3'
Posted On 2018-03-15