Incidental Mutation 'R6292:Hs3st1'
ID 508491
Institutional Source Beutler Lab
Gene Symbol Hs3st1
Ensembl Gene ENSMUSG00000051022
Gene Name heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Synonyms D5Wsu110e, 3-OST
MMRRC Submission 044461-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R6292 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 39771278-39802935 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39772133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 170 (Q170L)
Ref Sequence ENSEMBL: ENSMUSP00000114997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053116] [ENSMUST00000117944] [ENSMUST00000137142] [ENSMUST00000152057]
AlphaFold O35310
Predicted Effect possibly damaging
Transcript: ENSMUST00000053116
AA Change: Q170L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051055
Gene: ENSMUSG00000051022
AA Change: Q170L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117944
AA Change: Q170L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113919
Gene: ENSMUSG00000051022
AA Change: Q170L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137142
AA Change: Q170L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114997
Gene: ENSMUSG00000051022
AA Change: Q170L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 177 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152057
SMART Domains Protein: ENSMUSP00000118060
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1fmja_ 25 74 1e-5 SMART
PDB:1VKJ|C 40 75 6e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200697
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It possesses both heparan sulfate glucosaminyl 3-O-sulfotransferase activity, anticoagulant heparan sulfate conversion activity, and is a rate limiting enzyme for synthesis of anticoagulant heparan. This enzyme is an intraluminal Golgi resident protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth retardation and death between postnatal days 2-3 when bred on a C57BL/6J background. Mice homozygous for this mutation on a 129 background are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,338,312 (GRCm39) V709E probably damaging Het
Ankrd33b C T 15: 31,325,231 (GRCm39) probably null Het
Apaf1 T C 10: 90,827,425 (GRCm39) T1202A possibly damaging Het
Apip G T 2: 102,922,812 (GRCm39) C210F probably benign Het
Chd9 A T 8: 91,659,550 (GRCm39) H170L probably benign Het
Clec16a T C 16: 10,378,015 (GRCm39) probably null Het
Ep300 T A 15: 81,500,935 (GRCm39) probably benign Het
Etl4 C T 2: 20,748,384 (GRCm39) H39Y probably damaging Het
Gdap1l1 A T 2: 163,293,427 (GRCm39) I218F probably damaging Het
Gm5141 A T 13: 62,922,252 (GRCm39) C306S probably damaging Het
Gm9961 C T 16: 11,748,336 (GRCm39) noncoding transcript Het
Gpr27 C T 6: 99,670,619 (GRCm39) S327L possibly damaging Het
Hectd3 A C 4: 116,856,005 (GRCm39) T435P probably damaging Het
Hykk T C 9: 54,828,110 (GRCm39) probably null Het
Lilra5 T C 7: 4,241,338 (GRCm39) S92P possibly damaging Het
Lrig1 A T 6: 94,593,426 (GRCm39) N418K probably damaging Het
Miga1 A G 3: 152,023,356 (GRCm39) F232L probably benign Het
Mkrn2 T A 6: 115,590,295 (GRCm39) M217K probably damaging Het
Myh7b A T 2: 155,474,316 (GRCm39) Q1677L probably damaging Het
N4bp1 T C 8: 87,579,867 (GRCm39) E645G probably damaging Het
Nckap5 T C 1: 125,842,752 (GRCm39) K1752E probably damaging Het
Nek1 A G 8: 61,507,770 (GRCm39) probably null Het
Ntng1 T C 3: 110,051,202 (GRCm39) probably benign Het
Nup133 A G 8: 124,644,176 (GRCm39) V730A probably benign Het
Or2t44 T A 11: 58,677,063 (GRCm39) M1K probably null Het
Or51v14 T A 7: 103,261,386 (GRCm39) H58L probably damaging Het
Paqr6 C T 3: 88,275,205 (GRCm39) P213S probably damaging Het
Pign A T 1: 105,512,802 (GRCm39) V627D possibly damaging Het
Rasal1 T A 5: 120,797,685 (GRCm39) V139E probably damaging Het
Scgb1b24 G T 7: 33,443,577 (GRCm39) A79S possibly damaging Het
Slc25a28 T C 19: 43,653,031 (GRCm39) D210G probably benign Het
Slc38a3 A T 9: 107,532,353 (GRCm39) I393N possibly damaging Het
Slc41a2 T C 10: 83,090,790 (GRCm39) N465D probably damaging Het
Slc5a5 G A 8: 71,343,822 (GRCm39) T160I probably damaging Het
Smarca2 C T 19: 26,608,292 (GRCm39) A117V probably damaging Het
Sorcs2 C T 5: 36,219,931 (GRCm39) R371H probably damaging Het
Taf4 A G 2: 179,565,780 (GRCm39) S872P probably damaging Het
Tdrd3 G T 14: 87,743,690 (GRCm39) C540F probably benign Het
Thumpd1 A T 7: 119,319,897 (GRCm39) L23Q probably benign Het
Top1 A T 2: 160,540,061 (GRCm39) Y213F probably benign Het
Txndc5 T C 13: 38,712,160 (GRCm39) probably null Het
Unc79 C A 12: 103,108,991 (GRCm39) A2005D possibly damaging Het
Upb1 T C 10: 75,274,005 (GRCm39) L344P probably damaging Het
Vmn1r72 T A 7: 11,403,579 (GRCm39) S290C probably benign Het
Vmn2r103 A G 17: 20,013,866 (GRCm39) I219M possibly damaging Het
Wapl A G 14: 34,451,152 (GRCm39) T729A probably damaging Het
Washc5 C T 15: 59,227,783 (GRCm39) R393H probably damaging Het
Other mutations in Hs3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Hs3st1 APN 5 39,772,100 (GRCm39) missense probably damaging 1.00
IGL03162:Hs3st1 APN 5 39,771,792 (GRCm39) nonsense probably null
R1105:Hs3st1 UTSW 5 39,772,041 (GRCm39) unclassified probably benign
R1539:Hs3st1 UTSW 5 39,771,791 (GRCm39) missense probably benign
R1577:Hs3st1 UTSW 5 39,772,393 (GRCm39) missense probably benign 0.01
R3857:Hs3st1 UTSW 5 39,772,256 (GRCm39) missense probably damaging 1.00
R3858:Hs3st1 UTSW 5 39,772,256 (GRCm39) missense probably damaging 1.00
R4730:Hs3st1 UTSW 5 39,772,148 (GRCm39) nonsense probably null
R6091:Hs3st1 UTSW 5 39,772,007 (GRCm39) missense probably damaging 1.00
R6194:Hs3st1 UTSW 5 39,771,748 (GRCm39) missense probably damaging 0.96
R6213:Hs3st1 UTSW 5 39,771,864 (GRCm39) missense probably damaging 1.00
R7453:Hs3st1 UTSW 5 39,772,310 (GRCm39) missense probably damaging 1.00
R8276:Hs3st1 UTSW 5 39,772,146 (GRCm39) missense probably damaging 0.98
R9196:Hs3st1 UTSW 5 39,771,962 (GRCm39) missense probably damaging 0.96
R9324:Hs3st1 UTSW 5 39,772,145 (GRCm39) missense probably damaging 1.00
R9384:Hs3st1 UTSW 5 39,771,962 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAAGGGTCTCTGATGAGGCG -3'
(R):5'- ACTGGGAGGAGCATTACAGC -3'

Sequencing Primer
(F):5'- GGTCGCCATCCACAATGTG -3'
(R):5'- GAGCATTACAGCCAAGGCCTG -3'
Posted On 2018-03-15