Incidental Mutation 'R6292:Hs3st1'
List |< first << previous [record 14 of 48] next >> last >|
ID508491
Institutional Source Beutler Lab
Gene Symbol Hs3st1
Ensembl Gene ENSMUSG00000051022
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 1
SynonymsD5Wsu110e, 3-OST
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6292 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location39613935-39755475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39614790 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 170 (Q170L)
Ref Sequence ENSEMBL: ENSMUSP00000114997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053116] [ENSMUST00000117944] [ENSMUST00000137142] [ENSMUST00000152057]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053116
AA Change: Q170L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051055
Gene: ENSMUSG00000051022
AA Change: Q170L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117944
AA Change: Q170L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113919
Gene: ENSMUSG00000051022
AA Change: Q170L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 302 5.7e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137142
AA Change: Q170L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114997
Gene: ENSMUSG00000051022
AA Change: Q170L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sulfotransfer_1 58 177 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152057
SMART Domains Protein: ENSMUSP00000118060
Gene: ENSMUSG00000051022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1fmja_ 25 74 1e-5 SMART
PDB:1VKJ|C 40 75 6e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200697
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It possesses both heparan sulfate glucosaminyl 3-O-sulfotransferase activity, anticoagulant heparan sulfate conversion activity, and is a rate limiting enzyme for synthesis of anticoagulant heparan. This enzyme is an intraluminal Golgi resident protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth retardation and death between postnatal days 2-3 when bred on a C57BL/6J background. Mice homozygous for this mutation on a 129 background are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Hs3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Hs3st1 APN 5 39614757 missense probably damaging 1.00
IGL03162:Hs3st1 APN 5 39614449 nonsense probably null
R1105:Hs3st1 UTSW 5 39614698 unclassified probably benign
R1539:Hs3st1 UTSW 5 39614448 missense probably benign
R1577:Hs3st1 UTSW 5 39615050 missense probably benign 0.01
R3857:Hs3st1 UTSW 5 39614913 missense probably damaging 1.00
R3858:Hs3st1 UTSW 5 39614913 missense probably damaging 1.00
R4730:Hs3st1 UTSW 5 39614805 nonsense probably null
R6091:Hs3st1 UTSW 5 39614664 missense probably damaging 1.00
R6194:Hs3st1 UTSW 5 39614405 missense probably damaging 0.96
R6213:Hs3st1 UTSW 5 39614521 missense probably damaging 1.00
R7453:Hs3st1 UTSW 5 39614967 missense probably damaging 1.00
R8276:Hs3st1 UTSW 5 39614803 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGGGTCTCTGATGAGGCG -3'
(R):5'- ACTGGGAGGAGCATTACAGC -3'

Sequencing Primer
(F):5'- GGTCGCCATCCACAATGTG -3'
(R):5'- GAGCATTACAGCCAAGGCCTG -3'
Posted On2018-03-15