Mutagenetix > Incidental Mutation

Incidental Mutation 'R6292:Lrig1'

508494

Institutional Source

Beutler Lab

Gene Symbol

Lrig1

Ensembl Gene

ENSMUSG00000030029

Gene Name

leucine-rich repeats and immunoglobulin-like domains 1

Synonyms

LIG-1, Img

MMRRC Submission

Accession Numbers

Genbank: NM_008377; MGI: 107935

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94604529-94700158 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94616445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 418 (N418K)

Ref Sequence

ENSEMBL: ENSMUSP00000144963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000101126] [ENSMUST00000204645]

AlphaFold

P70193

Predicted Effect

probably damaging
Transcript: ENSMUST00000032105
AA Change: N418K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029
AA Change: N418K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101126
AA Change: N418K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029
AA Change: N418K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000204645
AA Change: N418K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029
AA Change: N418K

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,200,251	V709E	probably damaging	Het
Ankrd33b	C	T	15: 31,325,085		probably null	Het
Apaf1	T	C	10: 90,991,563	T1202A	possibly damaging	Het
Apip	G	T	2: 103,092,467	C210F	probably benign	Het
Chd9	A	T	8: 90,932,922	H170L	probably benign	Het
Clec16a	T	C	16: 10,560,151		probably null	Het
Ep300	T	A	15: 81,616,734		probably benign	Het
Etl4	C	T	2: 20,743,573	H39Y	probably damaging	Het
Gdap1l1	A	T	2: 163,451,507	I218F	probably damaging	Het
Gm5141	A	T	13: 62,774,438	C306S	probably damaging	Het
Gm9961	C	T	16: 11,930,472		noncoding transcript	Het
Gpr27	C	T	6: 99,693,658	S327L	possibly damaging	Het
Hectd3	A	C	4: 116,998,808	T435P	probably damaging	Het
Hs3st1	T	A	5: 39,614,790	Q170L	possibly damaging	Het
Hykk	T	C	9: 54,920,826		probably null	Het
Lilra5	T	C	7: 4,238,339	S92P	possibly damaging	Het
Miga1	A	G	3: 152,317,719	F232L	probably benign	Het
Mkrn2	T	A	6: 115,613,334	M217K	probably damaging	Het
Myh7b	A	T	2: 155,632,396	Q1677L	probably damaging	Het
N4bp1	T	C	8: 86,853,239	E645G	probably damaging	Het
Nckap5	T	C	1: 125,915,015	K1752E	probably damaging	Het
Nek1	A	G	8: 61,054,736		probably null	Het
Ntng1	T	C	3: 110,143,886		probably benign	Het
Nup133	A	G	8: 123,917,437	V730A	probably benign	Het
Olfr314	T	A	11: 58,786,237	M1K	probably null	Het
Olfr620	T	A	7: 103,612,179	H58L	probably damaging	Het
Paqr6	C	T	3: 88,367,898	P213S	probably damaging	Het
Pign	A	T	1: 105,585,077	V627D	possibly damaging	Het
Rasal1	T	A	5: 120,659,620	V139E	probably damaging	Het
Scgb1b24	G	T	7: 33,744,152	A79S	possibly damaging	Het
Slc25a28	T	C	19: 43,664,592	D210G	probably benign	Het
Slc38a3	A	T	9: 107,655,154	I393N	possibly damaging	Het
Slc41a2	T	C	10: 83,254,926	N465D	probably damaging	Het
Slc5a5	G	A	8: 70,891,178	T160I	probably damaging	Het
Smarca2	C	T	19: 26,630,892	A117V	probably damaging	Het
Sorcs2	C	T	5: 36,062,587	R371H	probably damaging	Het
Taf4	A	G	2: 179,923,987	S872P	probably damaging	Het
Tdrd3	G	T	14: 87,506,254	C540F	probably benign	Het
Thumpd1	A	T	7: 119,720,674	L23Q	probably benign	Het
Top1	A	T	2: 160,698,141	Y213F	probably benign	Het
Txndc5	T	C	13: 38,528,184		probably null	Het
Unc79	C	A	12: 103,142,732	A2005D	possibly damaging	Het
Upb1	T	C	10: 75,438,171	L344P	probably damaging	Het
Vmn1r72	T	A	7: 11,669,652	S290C	probably benign	Het
Vmn2r103	A	G	17: 19,793,604	I219M	possibly damaging	Het
Wapl	A	G	14: 34,729,195	T729A	probably damaging	Het
Washc5	C	T	15: 59,355,934	R393H	probably damaging	Het

Other mutations in Lrig1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Lrig1	APN	6	94611404	missense	probably damaging	0.99
IGL01356:Lrig1	APN	6	94654920	missense	probably benign	0.00
IGL01356:Lrig1	APN	6	94609893	missense	probably damaging	1.00
IGL02001:Lrig1	APN	6	94607324	missense	probably benign	0.00
IGL02019:Lrig1	APN	6	94616429	missense	probably damaging	0.98
IGL02177:Lrig1	APN	6	94663996	missense	possibly damaging	0.76
IGL02274:Lrig1	APN	6	94663938	missense	possibly damaging	0.90
IGL03197:Lrig1	APN	6	94606118	missense	probably benign
IGL03263:Lrig1	APN	6	94611647	missense	probably benign	0.00
IGL03327:Lrig1	APN	6	94606123	missense	probably benign	0.10
N/A - 293:Lrig1	UTSW	6	94609087	missense	probably benign
R0019:Lrig1	UTSW	6	94607349	nonsense	probably null
R0019:Lrig1	UTSW	6	94607349	nonsense	probably null
R0961:Lrig1	UTSW	6	94663914	splice site	probably benign
R1018:Lrig1	UTSW	6	94622602	splice site	probably benign
R1381:Lrig1	UTSW	6	94606130	missense	probably benign	0.04
R1473:Lrig1	UTSW	6	94607313	missense	probably benign	0.16
R1498:Lrig1	UTSW	6	94627987	missense	possibly damaging	0.89
R1888:Lrig1	UTSW	6	94654878	missense	probably benign	0.03
R1888:Lrig1	UTSW	6	94654878	missense	probably benign	0.03
R2273:Lrig1	UTSW	6	94608143	missense	probably damaging	1.00
R2513:Lrig1	UTSW	6	94617366	splice site	probably null
R3001:Lrig1	UTSW	6	94608777	missense	probably damaging	1.00
R3002:Lrig1	UTSW	6	94608777	missense	probably damaging	1.00
R3732:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3732:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3733:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3772:Lrig1	UTSW	6	94605817	missense	probably benign	0.00
R4089:Lrig1	UTSW	6	94609859	missense	possibly damaging	0.83
R4093:Lrig1	UTSW	6	94613578	missense	probably benign	0.10
R4095:Lrig1	UTSW	6	94613578	missense	probably benign	0.10
R4225:Lrig1	UTSW	6	94622658	missense	probably damaging	1.00
R4917:Lrig1	UTSW	6	94609719	missense	probably damaging	1.00
R4951:Lrig1	UTSW	6	94663978	missense	probably damaging	1.00
R4976:Lrig1	UTSW	6	94625062	missense	probably damaging	1.00
R5000:Lrig1	UTSW	6	94611449	missense	probably damaging	1.00
R5149:Lrig1	UTSW	6	94628044	missense	possibly damaging	0.93
R5732:Lrig1	UTSW	6	94699539	nonsense	probably null
R5988:Lrig1	UTSW	6	94628042	missense	probably damaging	0.99
R6064:Lrig1	UTSW	6	94626447	missense	probably damaging	1.00
R6723:Lrig1	UTSW	6	94626405	missense	probably damaging	1.00
R6815:Lrig1	UTSW	6	94625029	missense	probably damaging	1.00
R6889:Lrig1	UTSW	6	94625063	missense	probably benign	0.07
R6995:Lrig1	UTSW	6	94611629	missense	possibly damaging	0.95
R7404:Lrig1	UTSW	6	94626471	missense	probably damaging	1.00
R7487:Lrig1	UTSW	6	94606118	missense	probably benign
R7732:Lrig1	UTSW	6	94626377	missense	probably benign	0.05
R7915:Lrig1	UTSW	6	94630101	critical splice donor site	probably null
R8133:Lrig1	UTSW	6	94611629	missense	possibly damaging	0.95
R8768:Lrig1	UTSW	6	94654859	missense	possibly damaging	0.88
R9045:Lrig1	UTSW	6	94608707	critical splice donor site	probably null
R9227:Lrig1	UTSW	6	94630132	missense	probably damaging	1.00
Z1176:Lrig1	UTSW	6	94609026	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TAAGTCCCATCCGGCATTTTGC -3'
(R):5'- TCTGTGTGCTTGCAACAACAG -3'

Sequencing Primer
(F):5'- CCGGCATTTTGCTTTTAAAGAC -3'
(R):5'- AGGAGAACCGAGAGCCTCTC -3'

Posted On

2018-03-15