Mutagenetix > Incidental Mutation

Incidental Mutation 'R6292:Lilra5'

508497

Institutional Source

Beutler Lab

Gene Symbol

Lilra5

Ensembl Gene

ENSMUSG00000070873

Gene Name

leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5

Synonyms

Gm4878

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R6292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4237754-4243463 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4238339 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 92 (S92P)

Ref Sequence

ENSEMBL: ENSMUSP00000113091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117550]

AlphaFold

D3Z7A9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117550
AA Change: S92P

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113091
Gene: ENSMUSG00000070873
AA Change: S92P

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	34	118	4.67e-4	SMART
IG_like	129	217	5.13e0	SMART
transmembrane domain	250	267	N/A	INTRINSIC

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,200,251	V709E	probably damaging	Het
Ankrd33b	C	T	15: 31,325,085		probably null	Het
Apaf1	T	C	10: 90,991,563	T1202A	possibly damaging	Het
Apip	G	T	2: 103,092,467	C210F	probably benign	Het
Chd9	A	T	8: 90,932,922	H170L	probably benign	Het
Clec16a	T	C	16: 10,560,151		probably null	Het
Ep300	T	A	15: 81,616,734		probably benign	Het
Etl4	C	T	2: 20,743,573	H39Y	probably damaging	Het
Gdap1l1	A	T	2: 163,451,507	I218F	probably damaging	Het
Gm5141	A	T	13: 62,774,438	C306S	probably damaging	Het
Gm9961	C	T	16: 11,930,472		noncoding transcript	Het
Gpr27	C	T	6: 99,693,658	S327L	possibly damaging	Het
Hectd3	A	C	4: 116,998,808	T435P	probably damaging	Het
Hs3st1	T	A	5: 39,614,790	Q170L	possibly damaging	Het
Hykk	T	C	9: 54,920,826		probably null	Het
Lrig1	A	T	6: 94,616,445	N418K	probably damaging	Het
Miga1	A	G	3: 152,317,719	F232L	probably benign	Het
Mkrn2	T	A	6: 115,613,334	M217K	probably damaging	Het
Myh7b	A	T	2: 155,632,396	Q1677L	probably damaging	Het
N4bp1	T	C	8: 86,853,239	E645G	probably damaging	Het
Nckap5	T	C	1: 125,915,015	K1752E	probably damaging	Het
Nek1	A	G	8: 61,054,736		probably null	Het
Ntng1	T	C	3: 110,143,886		probably benign	Het
Nup133	A	G	8: 123,917,437	V730A	probably benign	Het
Olfr314	T	A	11: 58,786,237	M1K	probably null	Het
Olfr620	T	A	7: 103,612,179	H58L	probably damaging	Het
Paqr6	C	T	3: 88,367,898	P213S	probably damaging	Het
Pign	A	T	1: 105,585,077	V627D	possibly damaging	Het
Rasal1	T	A	5: 120,659,620	V139E	probably damaging	Het
Scgb1b24	G	T	7: 33,744,152	A79S	possibly damaging	Het
Slc25a28	T	C	19: 43,664,592	D210G	probably benign	Het
Slc38a3	A	T	9: 107,655,154	I393N	possibly damaging	Het
Slc41a2	T	C	10: 83,254,926	N465D	probably damaging	Het
Slc5a5	G	A	8: 70,891,178	T160I	probably damaging	Het
Smarca2	C	T	19: 26,630,892	A117V	probably damaging	Het
Sorcs2	C	T	5: 36,062,587	R371H	probably damaging	Het
Taf4	A	G	2: 179,923,987	S872P	probably damaging	Het
Tdrd3	G	T	14: 87,506,254	C540F	probably benign	Het
Thumpd1	A	T	7: 119,720,674	L23Q	probably benign	Het
Top1	A	T	2: 160,698,141	Y213F	probably benign	Het
Txndc5	T	C	13: 38,528,184		probably null	Het
Unc79	C	A	12: 103,142,732	A2005D	possibly damaging	Het
Upb1	T	C	10: 75,438,171	L344P	probably damaging	Het
Vmn1r72	T	A	7: 11,669,652	S290C	probably benign	Het
Vmn2r103	A	G	17: 19,793,604	I219M	possibly damaging	Het
Wapl	A	G	14: 34,729,195	T729A	probably damaging	Het
Washc5	C	T	15: 59,355,934	R393H	probably damaging	Het

Other mutations in Lilra5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02189:Lilra5	APN	7	4237969	missense	probably benign
IGL02281:Lilra5	APN	7	4238783	missense	probably benign	0.00
R0458:Lilra5	UTSW	7	4238219	missense	probably benign	0.26
R0611:Lilra5	UTSW	7	4242233	missense	probably benign
R0685:Lilra5	UTSW	7	4241957	splice site	probably benign
R3195:Lilra5	UTSW	7	4238757	missense	probably damaging	0.96
R4726:Lilra5	UTSW	7	4237958	missense	probably benign	0.00
R4745:Lilra5	UTSW	7	4242077	missense	possibly damaging	0.72
R4836:Lilra5	UTSW	7	4238714	missense	possibly damaging	0.71
R6034:Lilra5	UTSW	7	4242134	missense	probably benign	0.33
R6034:Lilra5	UTSW	7	4242134	missense	probably benign	0.33
R6263:Lilra5	UTSW	7	4238361	missense	probably damaging	1.00
R6266:Lilra5	UTSW	7	4241928	missense	possibly damaging	0.84
R6285:Lilra5	UTSW	7	4242115	missense	probably damaging	1.00
R6344:Lilra5	UTSW	7	4238786	missense	probably damaging	1.00
R6861:Lilra5	UTSW	7	4241932	missense	probably benign	0.14
R8353:Lilra5	UTSW	7	4237972	missense	probably benign	0.06
R8681:Lilra5	UTSW	7	4238217	missense	probably benign	0.17
R8844:Lilra5	UTSW	7	4238664	missense	probably damaging	0.99
R8867:Lilra5	UTSW	7	4238166	missense	possibly damaging	0.46
R8975:Lilra5	UTSW	7	4238637	missense	probably benign	0.03
R9393:Lilra5	UTSW	7	4237759	start codon destroyed	probably null	1.00
R9646:Lilra5	UTSW	7	4241908	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTTGCAGGGAATCCGCACAAG -3'
(R):5'- AAGTGGGACTATCCAGGCTG -3'

Sequencing Primer
(F):5'- AACCCTTAGTGTTCAGCCAGG -3'
(R):5'- GACTATCCAGGCTGCATTGC -3'

Posted On

2018-03-15