Incidental Mutation 'R6292:Scgb1b24'
List |< first << previous [record 31 of 48] next >> last >|
ID508499
Institutional Source Beutler Lab
Gene Symbol Scgb1b24
Ensembl Gene ENSMUSG00000078753
Gene Namesecretoglobin, family 1B, member 24
SynonymsGm12769, Abpa24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6292 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location33743799-33744982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33744152 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 79 (A79S)
Ref Sequence ENSEMBL: ENSMUSP00000103722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055444] [ENSMUST00000108087]
Predicted Effect probably benign
Transcript: ENSMUST00000055444
SMART Domains Protein: ENSMUSP00000052456
Gene: ENSMUSG00000046438

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
Pfam:Feld-I_B 24 90 5.9e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108087
AA Change: A79S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103722
Gene: ENSMUSG00000078753
AA Change: A79S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
UTG 23 92 4.95e-15 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Scgb1b24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Scgb1b24 APN 7 33744009 missense probably damaging 1.00
IGL01906:Scgb1b24 APN 7 33744113 missense probably damaging 0.98
IGL02268:Scgb1b24 APN 7 33744963 missense possibly damaging 0.95
R0268:Scgb1b24 UTSW 7 33743853 missense probably null 1.00
R1869:Scgb1b24 UTSW 7 33744044 missense probably damaging 0.99
R5229:Scgb1b24 UTSW 7 33744095 missense possibly damaging 0.95
R7444:Scgb1b24 UTSW 7 33744141 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACTCTGGGATGTGCTGGTAC -3'
(R):5'- ACTCAGGCAGGGATCTAGTG -3'

Sequencing Primer
(F):5'- GCTGGTACATGTCTTTCAATGAAG -3'
(R):5'- CAGGGATCTAGTGTGGCTTGGC -3'
Posted On2018-03-15