Incidental Mutation 'R6292:Olfr620'
ID508500
Institutional Source Beutler Lab
Gene Symbol Olfr620
Ensembl Gene ENSMUSG00000045132
Gene Nameolfactory receptor 620
SynonymsMOR4-1, GA_x6K02T2PBJ9-6335095-6334154
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6292 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103604895-103612534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103612179 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 58 (H58L)
Ref Sequence ENSEMBL: ENSMUSP00000148869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052152] [ENSMUST00000217603]
Predicted Effect probably damaging
Transcript: ENSMUST00000052152
AA Change: H58L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061764
Gene: ENSMUSG00000045132
AA Change: H58L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.6e-137 PFAM
Pfam:7tm_1 43 294 4.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215752
Predicted Effect probably damaging
Transcript: ENSMUST00000217603
AA Change: H58L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Olfr620
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02807:Olfr620 APN 7 103611991 missense probably benign 0.34
R0496:Olfr620 UTSW 7 103611997 missense probably benign 0.09
R0834:Olfr620 UTSW 7 103612237 missense probably benign 0.00
R1957:Olfr620 UTSW 7 103611411 makesense probably null
R1958:Olfr620 UTSW 7 103611411 makesense probably null
R2158:Olfr620 UTSW 7 103612236 missense possibly damaging 0.66
R3797:Olfr620 UTSW 7 103611447 missense probably benign 0.37
R5389:Olfr620 UTSW 7 103611590 nonsense probably null
R6374:Olfr620 UTSW 7 103611921 missense probably benign 0.23
R6422:Olfr620 UTSW 7 103612014 missense probably damaging 1.00
R6586:Olfr620 UTSW 7 103611976 missense possibly damaging 0.81
R7234:Olfr620 UTSW 7 103611882 missense probably damaging 0.97
R7393:Olfr620 UTSW 7 103611991 missense possibly damaging 0.90
R7855:Olfr620 UTSW 7 103611772 missense possibly damaging 0.88
R7900:Olfr620 UTSW 7 103611693 missense possibly damaging 0.82
R8159:Olfr620 UTSW 7 103612140 missense possibly damaging 0.63
R8265:Olfr620 UTSW 7 103611841 missense possibly damaging 0.95
R8314:Olfr620 UTSW 7 103612047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCGGTCAAAGGACATGGC -3'
(R):5'- TCGAGAAAACAGGGTTTCTCC -3'

Sequencing Primer
(F):5'- CGAGGAGGACAGAGGACTCC -3'
(R):5'- GGGTTTCTCCATGATAACATCAAAGG -3'
Posted On2018-03-15