Mutagenetix > Incidental Mutation

Incidental Mutation 'R6292:Nek1'

508502

Institutional Source

Beutler Lab

Gene Symbol

Nek1

Ensembl Gene

ENSMUSG00000031644

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 1

Synonyms

kidney, anemia and testis, kat, D8Ertd790e

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6292 (G1)

Quality Score

126.008

Status

Validated

Chromosome

Chromosomal Location

60993195-61131346 bp(+) (GRCm38)

Type of Mutation

splice site (114 bp from exon)

DNA Base Change (assembly)

A to G at 61054736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]

AlphaFold

P51954

Predicted Effect

probably null
Transcript: ENSMUST00000034065

SMART Domains

Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	556	592	N/A	INTRINSIC
coiled coil region	647	685	N/A	INTRINSIC
low complexity region	767	780	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120689

SMART Domains

Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	487	510	N/A	INTRINSIC
low complexity region	521	533	N/A	INTRINSIC
coiled coil region	584	620	N/A	INTRINSIC
coiled coil region	675	713	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC
low complexity region	1158	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142601

SMART Domains

Protein: ENSMUSP00000121479
Gene: ENSMUSG00000031644

Domain	Start	End	E-Value	Type
low complexity region	38	47	N/A	INTRINSIC
coiled coil region	162	198	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155664

Predicted Effect

probably null
Transcript: ENSMUST00000211256

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211661

Predicted Effect

probably null
Transcript: ENSMUST00000211672

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,200,251	V709E	probably damaging	Het
Ankrd33b	C	T	15: 31,325,085		probably null	Het
Apaf1	T	C	10: 90,991,563	T1202A	possibly damaging	Het
Apip	G	T	2: 103,092,467	C210F	probably benign	Het
Chd9	A	T	8: 90,932,922	H170L	probably benign	Het
Clec16a	T	C	16: 10,560,151		probably null	Het
Ep300	T	A	15: 81,616,734		probably benign	Het
Etl4	C	T	2: 20,743,573	H39Y	probably damaging	Het
Gdap1l1	A	T	2: 163,451,507	I218F	probably damaging	Het
Gm5141	A	T	13: 62,774,438	C306S	probably damaging	Het
Gm9961	C	T	16: 11,930,472		noncoding transcript	Het
Gpr27	C	T	6: 99,693,658	S327L	possibly damaging	Het
Hectd3	A	C	4: 116,998,808	T435P	probably damaging	Het
Hs3st1	T	A	5: 39,614,790	Q170L	possibly damaging	Het
Hykk	T	C	9: 54,920,826		probably null	Het
Lilra5	T	C	7: 4,238,339	S92P	possibly damaging	Het
Lrig1	A	T	6: 94,616,445	N418K	probably damaging	Het
Miga1	A	G	3: 152,317,719	F232L	probably benign	Het
Mkrn2	T	A	6: 115,613,334	M217K	probably damaging	Het
Myh7b	A	T	2: 155,632,396	Q1677L	probably damaging	Het
N4bp1	T	C	8: 86,853,239	E645G	probably damaging	Het
Nckap5	T	C	1: 125,915,015	K1752E	probably damaging	Het
Ntng1	T	C	3: 110,143,886		probably benign	Het
Nup133	A	G	8: 123,917,437	V730A	probably benign	Het
Olfr314	T	A	11: 58,786,237	M1K	probably null	Het
Olfr620	T	A	7: 103,612,179	H58L	probably damaging	Het
Paqr6	C	T	3: 88,367,898	P213S	probably damaging	Het
Pign	A	T	1: 105,585,077	V627D	possibly damaging	Het
Rasal1	T	A	5: 120,659,620	V139E	probably damaging	Het
Scgb1b24	G	T	7: 33,744,152	A79S	possibly damaging	Het
Slc25a28	T	C	19: 43,664,592	D210G	probably benign	Het
Slc38a3	A	T	9: 107,655,154	I393N	possibly damaging	Het
Slc41a2	T	C	10: 83,254,926	N465D	probably damaging	Het
Slc5a5	G	A	8: 70,891,178	T160I	probably damaging	Het
Smarca2	C	T	19: 26,630,892	A117V	probably damaging	Het
Sorcs2	C	T	5: 36,062,587	R371H	probably damaging	Het
Taf4	A	G	2: 179,923,987	S872P	probably damaging	Het
Tdrd3	G	T	14: 87,506,254	C540F	probably benign	Het
Thumpd1	A	T	7: 119,720,674	L23Q	probably benign	Het
Top1	A	T	2: 160,698,141	Y213F	probably benign	Het
Txndc5	T	C	13: 38,528,184		probably null	Het
Unc79	C	A	12: 103,142,732	A2005D	possibly damaging	Het
Upb1	T	C	10: 75,438,171	L344P	probably damaging	Het
Vmn1r72	T	A	7: 11,669,652	S290C	probably benign	Het
Vmn2r103	A	G	17: 19,793,604	I219M	possibly damaging	Het
Wapl	A	G	14: 34,729,195	T729A	probably damaging	Het
Washc5	C	T	15: 59,355,934	R393H	probably damaging	Het

Other mutations in Nek1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Nek1	APN	8	61043284	missense	probably benign	0.00
IGL01075:Nek1	APN	8	61124132	missense	possibly damaging	0.64
IGL01122:Nek1	APN	8	61120966	missense	possibly damaging	0.80
IGL01151:Nek1	APN	8	61020077	missense	probably damaging	1.00
IGL01286:Nek1	APN	8	61124216	missense	possibly damaging	0.64
IGL01377:Nek1	APN	8	61089456	missense	probably benign
IGL01485:Nek1	APN	8	61049826	missense	probably benign	0.02
IGL01688:Nek1	APN	8	61105597	nonsense	probably null
IGL01806:Nek1	APN	8	61124212	missense	possibly damaging	0.82
IGL02006:Nek1	APN	8	61104192	missense	probably benign	0.20
IGL02304:Nek1	APN	8	61012167	missense	probably damaging	1.00
IGL02659:Nek1	APN	8	61089480	missense	probably benign	0.16
IGL02662:Nek1	APN	8	61104184	missense	probably benign	0.00
IGL02801:Nek1	APN	8	61121061	critical splice donor site	probably null
IGL02806:Nek1	APN	8	61044086	missense	probably benign	0.15
IGL03037:Nek1	APN	8	61034052	missense	probably benign	0.16
IGL03252:Nek1	APN	8	61072330	nonsense	probably null
P0014:Nek1	UTSW	8	61071747	splice site	probably benign
R0019:Nek1	UTSW	8	61089734	missense	probably benign	0.01
R0403:Nek1	UTSW	8	61106855	missense	probably damaging	0.99
R0464:Nek1	UTSW	8	61072273	splice site	probably benign
R0726:Nek1	UTSW	8	61089592	missense	probably damaging	1.00
R0761:Nek1	UTSW	8	61089455	missense	probably benign
R0827:Nek1	UTSW	8	61105648	splice site	probably benign
R0972:Nek1	UTSW	8	61089431	splice site	probably null
R1268:Nek1	UTSW	8	61022264	missense	probably damaging	1.00
R1343:Nek1	UTSW	8	61028675	missense	probably damaging	1.00
R1415:Nek1	UTSW	8	61089686	missense	probably benign	0.00
R1466:Nek1	UTSW	8	61125136	splice site	probably benign
R1480:Nek1	UTSW	8	61124326	splice site	probably null
R1526:Nek1	UTSW	8	61049941	missense	probably benign	0.26
R1552:Nek1	UTSW	8	61006737	missense	probably damaging	0.99
R1606:Nek1	UTSW	8	61124276	missense	possibly damaging	0.82
R1650:Nek1	UTSW	8	61036076	missense	probably benign	0.00
R1757:Nek1	UTSW	8	61089813	splice site	probably null
R1808:Nek1	UTSW	8	61016230	missense	probably damaging	1.00
R1966:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R2067:Nek1	UTSW	8	61007162	missense	probably damaging	1.00
R2111:Nek1	UTSW	8	61124326	splice site	probably null
R2113:Nek1	UTSW	8	61016293	missense	probably damaging	1.00
R2143:Nek1	UTSW	8	61028696	missense	probably damaging	1.00
R2255:Nek1	UTSW	8	61089773	missense	probably damaging	1.00
R2422:Nek1	UTSW	8	61019901	missense	probably damaging	1.00
R3848:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3849:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3850:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R4418:Nek1	UTSW	8	61106864	missense	probably damaging	1.00
R4526:Nek1	UTSW	8	61106944	missense	probably damaging	0.99
R4533:Nek1	UTSW	8	61007213	missense	possibly damaging	0.95
R4544:Nek1	UTSW	8	61016304	nonsense	probably null
R4677:Nek1	UTSW	8	61028806	missense	probably damaging	0.99
R4739:Nek1	UTSW	8	61098511	missense	probably benign	0.32
R5068:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R5421:Nek1	UTSW	8	61006677	missense	possibly damaging	0.81
R5516:Nek1	UTSW	8	61089489	missense	probably benign	0.03
R5855:Nek1	UTSW	8	61016272	missense	probably damaging	1.00
R6125:Nek1	UTSW	8	61028701	missense	probably damaging	1.00
R6267:Nek1	UTSW	8	61072309	nonsense	probably null
R6296:Nek1	UTSW	8	61072309	nonsense	probably null
R6458:Nek1	UTSW	8	61100012	missense	probably benign	0.00
R6568:Nek1	UTSW	8	61106821	missense	probably benign	0.00
R6629:Nek1	UTSW	8	61054333	splice site	probably null
R6867:Nek1	UTSW	8	61072330	missense	possibly damaging	0.81
R7122:Nek1	UTSW	8	61106795	missense	probably benign	0.00
R7193:Nek1	UTSW	8	61073578	missense	probably damaging	0.99
R7272:Nek1	UTSW	8	61125086	missense	probably benign	0.34
R7356:Nek1	UTSW	8	61120960	missense	probably benign	0.02
R7368:Nek1	UTSW	8	61089707	missense	probably benign	0.24
R7478:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7479:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7512:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7715:Nek1	UTSW	8	61006760	missense	probably damaging	0.98
R7984:Nek1	UTSW	8	61121053	nonsense	probably null
R8271:Nek1	UTSW	8	61105612	missense	probably benign	0.04
R8431:Nek1	UTSW	8	61034032	missense	possibly damaging	0.95
R9076:Nek1	UTSW	8	61028734	missense	probably damaging	0.96
R9149:Nek1	UTSW	8	61121021	missense	probably damaging	1.00
R9250:Nek1	UTSW	8	61012117	missense	probably damaging	0.99
R9429:Nek1	UTSW	8	61106858	missense	probably benign
R9563:Nek1	UTSW	8	61124123	missense	probably benign	0.36
R9616:Nek1	UTSW	8	61020073	missense	probably damaging	0.99
RF023:Nek1	UTSW	8	61072745	splice site	probably null
X0028:Nek1	UTSW	8	61043258	missense	probably benign	0.19
X0066:Nek1	UTSW	8	61125128	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTACAGCGTAAACGAGAAGC -3'
(R):5'- AGTGAGACTTCCAACTTCCTCAC -3'

Sequencing Primer
(F):5'- GCTATGCAGAATAAAGCCCG -3'
(R):5'- CAAATACTATAATGTGTGTGTGTGTG -3'

Posted On

2018-03-15