Incidental Mutation 'R6292:Slc5a5'
ID 508503
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Name solute carrier family 5 (sodium iodide symporter), member 5
Synonyms NIS
MMRRC Submission 044461-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6292 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71335533-71345401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71343822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 160 (T160I)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809] [ENSMUST00000054220] [ENSMUST00000212129] [ENSMUST00000212796] [ENSMUST00000212709] [ENSMUST00000212494] [ENSMUST00000213053] [ENSMUST00000212378]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000809
AA Change: T160I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: T160I

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054220
SMART Domains Protein: ENSMUSP00000058368
Gene: ENSMUSG00000045128

DomainStartEndE-ValueType
Pfam:Ribosomal_L18ae 7 130 1.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212019
Predicted Effect probably benign
Transcript: ENSMUST00000212129
Predicted Effect probably benign
Transcript: ENSMUST00000212796
Predicted Effect probably benign
Transcript: ENSMUST00000212709
Predicted Effect probably benign
Transcript: ENSMUST00000212494
Predicted Effect probably benign
Transcript: ENSMUST00000213053
Predicted Effect probably benign
Transcript: ENSMUST00000212378
Meta Mutation Damage Score 0.2705 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,338,312 (GRCm39) V709E probably damaging Het
Ankrd33b C T 15: 31,325,231 (GRCm39) probably null Het
Apaf1 T C 10: 90,827,425 (GRCm39) T1202A possibly damaging Het
Apip G T 2: 102,922,812 (GRCm39) C210F probably benign Het
Chd9 A T 8: 91,659,550 (GRCm39) H170L probably benign Het
Clec16a T C 16: 10,378,015 (GRCm39) probably null Het
Ep300 T A 15: 81,500,935 (GRCm39) probably benign Het
Etl4 C T 2: 20,748,384 (GRCm39) H39Y probably damaging Het
Gdap1l1 A T 2: 163,293,427 (GRCm39) I218F probably damaging Het
Gm5141 A T 13: 62,922,252 (GRCm39) C306S probably damaging Het
Gm9961 C T 16: 11,748,336 (GRCm39) noncoding transcript Het
Gpr27 C T 6: 99,670,619 (GRCm39) S327L possibly damaging Het
Hectd3 A C 4: 116,856,005 (GRCm39) T435P probably damaging Het
Hs3st1 T A 5: 39,772,133 (GRCm39) Q170L possibly damaging Het
Hykk T C 9: 54,828,110 (GRCm39) probably null Het
Lilra5 T C 7: 4,241,338 (GRCm39) S92P possibly damaging Het
Lrig1 A T 6: 94,593,426 (GRCm39) N418K probably damaging Het
Miga1 A G 3: 152,023,356 (GRCm39) F232L probably benign Het
Mkrn2 T A 6: 115,590,295 (GRCm39) M217K probably damaging Het
Myh7b A T 2: 155,474,316 (GRCm39) Q1677L probably damaging Het
N4bp1 T C 8: 87,579,867 (GRCm39) E645G probably damaging Het
Nckap5 T C 1: 125,842,752 (GRCm39) K1752E probably damaging Het
Nek1 A G 8: 61,507,770 (GRCm39) probably null Het
Ntng1 T C 3: 110,051,202 (GRCm39) probably benign Het
Nup133 A G 8: 124,644,176 (GRCm39) V730A probably benign Het
Or2t44 T A 11: 58,677,063 (GRCm39) M1K probably null Het
Or51v14 T A 7: 103,261,386 (GRCm39) H58L probably damaging Het
Paqr6 C T 3: 88,275,205 (GRCm39) P213S probably damaging Het
Pign A T 1: 105,512,802 (GRCm39) V627D possibly damaging Het
Rasal1 T A 5: 120,797,685 (GRCm39) V139E probably damaging Het
Scgb1b24 G T 7: 33,443,577 (GRCm39) A79S possibly damaging Het
Slc25a28 T C 19: 43,653,031 (GRCm39) D210G probably benign Het
Slc38a3 A T 9: 107,532,353 (GRCm39) I393N possibly damaging Het
Slc41a2 T C 10: 83,090,790 (GRCm39) N465D probably damaging Het
Smarca2 C T 19: 26,608,292 (GRCm39) A117V probably damaging Het
Sorcs2 C T 5: 36,219,931 (GRCm39) R371H probably damaging Het
Taf4 A G 2: 179,565,780 (GRCm39) S872P probably damaging Het
Tdrd3 G T 14: 87,743,690 (GRCm39) C540F probably benign Het
Thumpd1 A T 7: 119,319,897 (GRCm39) L23Q probably benign Het
Top1 A T 2: 160,540,061 (GRCm39) Y213F probably benign Het
Txndc5 T C 13: 38,712,160 (GRCm39) probably null Het
Unc79 C A 12: 103,108,991 (GRCm39) A2005D possibly damaging Het
Upb1 T C 10: 75,274,005 (GRCm39) L344P probably damaging Het
Vmn1r72 T A 7: 11,403,579 (GRCm39) S290C probably benign Het
Vmn2r103 A G 17: 20,013,866 (GRCm39) I219M possibly damaging Het
Wapl A G 14: 34,451,152 (GRCm39) T729A probably damaging Het
Washc5 C T 15: 59,227,783 (GRCm39) R393H probably damaging Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 71,341,181 (GRCm39) missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 71,343,020 (GRCm39) unclassified probably benign
IGL01394:Slc5a5 APN 8 71,342,032 (GRCm39) nonsense probably null
IGL01571:Slc5a5 APN 8 71,343,976 (GRCm39) unclassified probably benign
IGL02043:Slc5a5 APN 8 71,345,073 (GRCm39) missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 71,338,764 (GRCm39) missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 71,341,555 (GRCm39) missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 71,342,915 (GRCm39) missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 71,345,161 (GRCm39) missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 71,342,972 (GRCm39) missense probably benign 0.45
R0234:Slc5a5 UTSW 8 71,342,277 (GRCm39) missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 71,342,277 (GRCm39) missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 71,344,319 (GRCm39) missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 71,336,519 (GRCm39) missense probably benign 0.01
R0781:Slc5a5 UTSW 8 71,342,864 (GRCm39) missense probably benign 0.19
R1061:Slc5a5 UTSW 8 71,342,865 (GRCm39) missense probably benign 0.00
R1400:Slc5a5 UTSW 8 71,342,079 (GRCm39) missense possibly damaging 0.87
R1524:Slc5a5 UTSW 8 71,344,978 (GRCm39) missense probably damaging 1.00
R2033:Slc5a5 UTSW 8 71,341,231 (GRCm39) missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 71,345,083 (GRCm39) missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 71,345,083 (GRCm39) missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2111:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2112:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2201:Slc5a5 UTSW 8 71,345,102 (GRCm39) missense probably damaging 0.98
R3978:Slc5a5 UTSW 8 71,342,039 (GRCm39) missense probably benign 0.00
R4244:Slc5a5 UTSW 8 71,342,930 (GRCm39) missense probably benign
R5161:Slc5a5 UTSW 8 71,341,492 (GRCm39) missense probably damaging 1.00
R5397:Slc5a5 UTSW 8 71,343,823 (GRCm39) missense probably damaging 1.00
R5718:Slc5a5 UTSW 8 71,340,399 (GRCm39) missense probably benign 0.00
R5740:Slc5a5 UTSW 8 71,341,561 (GRCm39) splice site probably null
R5869:Slc5a5 UTSW 8 71,344,974 (GRCm39) missense probably damaging 1.00
R6268:Slc5a5 UTSW 8 71,341,264 (GRCm39) missense probably damaging 1.00
R6290:Slc5a5 UTSW 8 71,343,822 (GRCm39) missense probably damaging 1.00
R7098:Slc5a5 UTSW 8 71,341,182 (GRCm39) missense probably damaging 0.99
R7354:Slc5a5 UTSW 8 71,342,247 (GRCm39) missense probably damaging 1.00
R8777:Slc5a5 UTSW 8 71,343,934 (GRCm39) missense possibly damaging 0.87
R8777-TAIL:Slc5a5 UTSW 8 71,343,934 (GRCm39) missense possibly damaging 0.87
R8903:Slc5a5 UTSW 8 71,345,227 (GRCm39) missense probably damaging 1.00
R9474:Slc5a5 UTSW 8 71,337,596 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACCTGAAGCTCACATGTC -3'
(R):5'- AACACCTTCTTGCAACCTGG -3'

Sequencing Primer
(F):5'- TCAGTCTTTATGTAGGAGAGGACAC -3'
(R):5'- TTGCAACCTGGCTCCGC -3'
Posted On 2018-03-15