Incidental Mutation 'R6292:Olfr314'
ID508512
Institutional Source Beutler Lab
Gene Symbol Olfr314
Ensembl Gene ENSMUSG00000059504
Gene Nameolfactory receptor 314
SynonymsMOR278-2, GA_x6K02T2NKPP-622179-621244
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6292 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58782952-58788768 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 58786237 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000145387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076393] [ENSMUST00000205189]
Predicted Effect probably null
Transcript: ENSMUST00000076393
AA Change: M1K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075729
Gene: ENSMUSG00000059504
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 26 306 2.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 249 2.1e-6 PFAM
Pfam:7tm_1 39 288 2.3e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205189
AA Change: M1K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145387
Gene: ENSMUSG00000059504
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 26 259 8.9e-42 PFAM
Pfam:7TM_GPCR_Srsx 33 246 9.4e-6 PFAM
Pfam:7tm_1 39 259 1.1e-25 PFAM
Meta Mutation Damage Score 0.8871 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Olfr314
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02036:Olfr314 APN 11 58787097 missense probably damaging 1.00
IGL02268:Olfr314 APN 11 58786725 missense probably benign 0.39
IGL02743:Olfr314 APN 11 58786780 nonsense probably null
R0157:Olfr314 UTSW 11 58787059 missense probably damaging 1.00
R0622:Olfr314 UTSW 11 58786341 missense probably damaging 1.00
R0926:Olfr314 UTSW 11 58787109 missense probably damaging 1.00
R1985:Olfr314 UTSW 11 58786384 missense probably damaging 0.99
R2273:Olfr314 UTSW 11 58786666 missense probably benign 0.00
R2274:Olfr314 UTSW 11 58786666 missense probably benign 0.00
R5642:Olfr314 UTSW 11 58786828 missense probably damaging 1.00
R5770:Olfr314 UTSW 11 58786594 missense probably benign 0.39
R6813:Olfr314 UTSW 11 58786646 missense probably benign 0.06
R7285:Olfr314 UTSW 11 58786484 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACTCACTGTTCTGGCGAG -3'
(R):5'- TTGGCTCAGGAGAAAGTACATG -3'

Sequencing Primer
(F):5'- TTTGACAGGTAAGCCTTGGAAATG -3'
(R):5'- AAGTACATGGGTGTGTGGAGCC -3'
Posted On2018-03-15