Incidental Mutation 'R6292:Gm5141'
List |< first << previous [record 10 of 48] next >> last >|
ID508514
Institutional Source Beutler Lab
Gene Symbol Gm5141
Ensembl Gene ENSMUSG00000091183
Gene Namepredicted gene 5141
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6292 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location62772200-62785808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62774438 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 306 (C306S)
Ref Sequence ENSEMBL: ENSMUSP00000144368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167516] [ENSMUST00000201047]
Predicted Effect probably damaging
Transcript: ENSMUST00000167516
AA Change: C305S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126604
Gene: ENSMUSG00000091183
AA Change: C305S

DomainStartEndE-ValueType
KRAB 3 65 2.32e-19 SMART
ZnF_C2H2 132 154 1.51e0 SMART
ZnF_C2H2 160 182 6.52e-5 SMART
ZnF_C2H2 188 210 5.42e-2 SMART
ZnF_C2H2 216 238 1.84e-4 SMART
ZnF_C2H2 244 266 1.3e-4 SMART
ZnF_C2H2 272 294 1.22e-4 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 328 350 2.79e-4 SMART
ZnF_C2H2 356 378 3.89e-3 SMART
ZnF_C2H2 384 406 4.94e-5 SMART
ZnF_C2H2 412 434 5.67e-5 SMART
ZnF_C2H2 440 462 7.49e-5 SMART
ZnF_C2H2 468 490 5.21e-4 SMART
ZnF_C2H2 496 518 4.87e-4 SMART
ZnF_C2H2 524 546 1.22e-4 SMART
ZnF_C2H2 552 574 1.18e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179519
Predicted Effect probably damaging
Transcript: ENSMUST00000201047
AA Change: C306S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144368
Gene: ENSMUSG00000091183
AA Change: C306S

DomainStartEndE-ValueType
KRAB 4 66 9.8e-22 SMART
ZnF_C2H2 133 155 6.5e-3 SMART
ZnF_C2H2 161 183 2.7e-7 SMART
ZnF_C2H2 189 211 2.4e-4 SMART
ZnF_C2H2 217 239 8.1e-7 SMART
ZnF_C2H2 245 267 5.6e-7 SMART
ZnF_C2H2 273 295 5.1e-7 SMART
ZnF_C2H2 301 323 7.9e-6 SMART
ZnF_C2H2 329 351 1.2e-6 SMART
ZnF_C2H2 357 379 1.7e-5 SMART
ZnF_C2H2 385 407 2.1e-7 SMART
ZnF_C2H2 413 435 2.4e-7 SMART
ZnF_C2H2 441 463 3.2e-7 SMART
ZnF_C2H2 469 491 2.2e-6 SMART
ZnF_C2H2 497 519 2.2e-6 SMART
ZnF_C2H2 525 547 5.4e-7 SMART
ZnF_C2H2 553 575 4.9e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202582
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Gm5141
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0220:Gm5141 UTSW 13 62774457 missense probably damaging 1.00
R0427:Gm5141 UTSW 13 62774711 missense probably damaging 1.00
R0534:Gm5141 UTSW 13 62774594 missense probably damaging 1.00
R0652:Gm5141 UTSW 13 62774132 missense probably damaging 1.00
R1495:Gm5141 UTSW 13 62774270 missense probably damaging 1.00
R2079:Gm5141 UTSW 13 62774610 missense probably benign 0.06
R4780:Gm5141 UTSW 13 62774950 missense unknown
R5588:Gm5141 UTSW 13 62773770 missense probably benign 0.06
R6455:Gm5141 UTSW 13 62774783 missense probably damaging 1.00
R6605:Gm5141 UTSW 13 62774387 missense probably damaging 1.00
R7091:Gm5141 UTSW 13 62773964 missense possibly damaging 0.80
R7199:Gm5141 UTSW 13 62777063 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGAAGGGTTTCTCTCCGGT -3'
(R):5'- AAAACCCTTCAAATGTAATCAGTGTGA -3'

Sequencing Primer
(F):5'- TGTGATGTGAAAAGGCTTTATCAC -3'
(R):5'- GAATGTGACAAAGCCTTTTCCC -3'
Posted On2018-03-15