Mutagenetix > Incidental Mutations

Incidental Mutation 'R6292:Wapl'

508515

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34729195 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 729 (T729A)

Ref Sequence

ENSEMBL: ENSMUSP00000130547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048263
AA Change: T729A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: T729A

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090027
AA Change: T723A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: T723A

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111895

Predicted Effect

unknown
Transcript: ENSMUST00000151285
AA Change: T13A

SMART Domains

Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: T13A

Domain	Start	End	E-Value	Type
Pfam:WAPL	1	281	1.1e-78	PFAM
coiled coil region	329	351	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169910
AA Change: T729A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: T729A

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172658

Meta Mutation Damage Score

0.6542

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,200,251	V709E	probably damaging	Het
Ankrd33b	C	T	15: 31,325,085		probably null	Het
Apaf1	T	C	10: 90,991,563	T1202A	possibly damaging	Het
Apip	G	T	2: 103,092,467	C210F	probably benign	Het
Chd9	A	T	8: 90,932,922	H170L	probably benign	Het
Clec16a	T	C	16: 10,560,151		probably null	Het
Ep300	T	A	15: 81,616,734		probably benign	Het
Etl4	C	T	2: 20,743,573	H39Y	probably damaging	Het
Gdap1l1	A	T	2: 163,451,507	I218F	probably damaging	Het
Gm5141	A	T	13: 62,774,438	C306S	probably damaging	Het
Gm9961	C	T	16: 11,930,472		noncoding transcript	Het
Gpr27	C	T	6: 99,693,658	S327L	possibly damaging	Het
Hectd3	A	C	4: 116,998,808	T435P	probably damaging	Het
Hs3st1	T	A	5: 39,614,790	Q170L	possibly damaging	Het
Hykk	T	C	9: 54,920,826		probably null	Het
Lilra5	T	C	7: 4,238,339	S92P	possibly damaging	Het
Lrig1	A	T	6: 94,616,445	N418K	probably damaging	Het
Miga1	A	G	3: 152,317,719	F232L	probably benign	Het
Mkrn2	T	A	6: 115,613,334	M217K	probably damaging	Het
Myh7b	A	T	2: 155,632,396	Q1677L	probably damaging	Het
N4bp1	T	C	8: 86,853,239	E645G	probably damaging	Het
Nckap5	T	C	1: 125,915,015	K1752E	probably damaging	Het
Nek1	A	G	8: 61,054,736		probably null	Het
Ntng1	T	C	3: 110,143,886		probably benign	Het
Nup133	A	G	8: 123,917,437	V730A	probably benign	Het
Olfr314	T	A	11: 58,786,237	M1K	probably null	Het
Olfr620	T	A	7: 103,612,179	H58L	probably damaging	Het
Paqr6	C	T	3: 88,367,898	P213S	probably damaging	Het
Pign	A	T	1: 105,585,077	V627D	possibly damaging	Het
Rasal1	T	A	5: 120,659,620	V139E	probably damaging	Het
Scgb1b24	G	T	7: 33,744,152	A79S	possibly damaging	Het
Slc25a28	T	C	19: 43,664,592	D210G	probably benign	Het
Slc38a3	A	T	9: 107,655,154	I393N	possibly damaging	Het
Slc41a2	T	C	10: 83,254,926	N465D	probably damaging	Het
Slc5a5	G	A	8: 70,891,178	T160I	probably damaging	Het
Smarca2	C	T	19: 26,630,892	A117V	probably damaging	Het
Sorcs2	C	T	5: 36,062,587	R371H	probably damaging	Het
Taf4	A	G	2: 179,923,987	S872P	probably damaging	Het
Tdrd3	G	T	14: 87,506,254	C540F	probably benign	Het
Thumpd1	A	T	7: 119,720,674	L23Q	probably benign	Het
Top1	A	T	2: 160,698,141	Y213F	probably benign	Het
Txndc5	T	C	13: 38,528,184		probably null	Het
Unc79	C	A	12: 103,142,732	A2005D	possibly damaging	Het
Upb1	T	C	10: 75,438,171	L344P	probably damaging	Het
Vmn1r72	T	A	7: 11,669,652	S290C	probably benign	Het
Vmn2r103	A	G	17: 19,793,604	I219M	possibly damaging	Het
Washc5	C	T	15: 59,355,934	R393H	probably damaging	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0278:Wapl	UTSW	14	34692612	missense	possibly damaging	0.68
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1295:Wapl	UTSW	14	34724769	missense	probably damaging	1.00
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3878:Wapl	UTSW	14	34692147	missense	probably damaging	1.00
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5079:Wapl	UTSW	14	34724757	missense	probably damaging	1.00
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5222:Wapl	UTSW	14	34736685	nonsense	probably null
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5541:Wapl	UTSW	14	34730662	critical splice donor site	probably null
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R6937:Wapl	UTSW	14	34722354	missense	probably benign	0.01
R7080:Wapl	UTSW	14	34692356	missense	probably benign	0.03
R7203:Wapl	UTSW	14	34736691	missense	probably benign
R8038:Wapl	UTSW	14	34691682	missense	probably benign
R8053:Wapl	UTSW	14	34692321	missense	probably damaging	1.00
Z1177:Wapl	UTSW	14	34745690	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTTCAAAGAAATGGGTAGCG -3'
(R):5'- TGTGCACAGTTTCACAGAGTC -3'

Sequencing Primer
(F):5'- CAAATAGCTATGTTTCCCTAGGC -3'
(R):5'- GCACAGTTTCACAGAGTCTTCGG -3'

Posted On

2018-03-15