Incidental Mutation 'R6292:Clec16a'
ID 508520
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene Name C-type lectin domain family 16, member A
Synonyms curt, 4932416N17Rik
MMRRC Submission 044461-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R6292 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 10363203-10562742 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 10378015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038145] [ENSMUST00000066345] [ENSMUST00000115824] [ENSMUST00000115827] [ENSMUST00000115828] [ENSMUST00000155633] [ENSMUST00000150894]
AlphaFold Q80U30
Predicted Effect probably null
Transcript: ENSMUST00000038145
SMART Domains Protein: ENSMUSP00000040267
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 9.2e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
low complexity region 897 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066345
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115824
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115827
SMART Domains Protein: ENSMUSP00000111493
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 8.7e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115828
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130148
Predicted Effect probably null
Transcript: ENSMUST00000155633
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150894
SMART Domains Protein: ENSMUSP00000114577
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,338,312 (GRCm39) V709E probably damaging Het
Ankrd33b C T 15: 31,325,231 (GRCm39) probably null Het
Apaf1 T C 10: 90,827,425 (GRCm39) T1202A possibly damaging Het
Apip G T 2: 102,922,812 (GRCm39) C210F probably benign Het
Chd9 A T 8: 91,659,550 (GRCm39) H170L probably benign Het
Ep300 T A 15: 81,500,935 (GRCm39) probably benign Het
Etl4 C T 2: 20,748,384 (GRCm39) H39Y probably damaging Het
Gdap1l1 A T 2: 163,293,427 (GRCm39) I218F probably damaging Het
Gm5141 A T 13: 62,922,252 (GRCm39) C306S probably damaging Het
Gm9961 C T 16: 11,748,336 (GRCm39) noncoding transcript Het
Gpr27 C T 6: 99,670,619 (GRCm39) S327L possibly damaging Het
Hectd3 A C 4: 116,856,005 (GRCm39) T435P probably damaging Het
Hs3st1 T A 5: 39,772,133 (GRCm39) Q170L possibly damaging Het
Hykk T C 9: 54,828,110 (GRCm39) probably null Het
Lilra5 T C 7: 4,241,338 (GRCm39) S92P possibly damaging Het
Lrig1 A T 6: 94,593,426 (GRCm39) N418K probably damaging Het
Miga1 A G 3: 152,023,356 (GRCm39) F232L probably benign Het
Mkrn2 T A 6: 115,590,295 (GRCm39) M217K probably damaging Het
Myh7b A T 2: 155,474,316 (GRCm39) Q1677L probably damaging Het
N4bp1 T C 8: 87,579,867 (GRCm39) E645G probably damaging Het
Nckap5 T C 1: 125,842,752 (GRCm39) K1752E probably damaging Het
Nek1 A G 8: 61,507,770 (GRCm39) probably null Het
Ntng1 T C 3: 110,051,202 (GRCm39) probably benign Het
Nup133 A G 8: 124,644,176 (GRCm39) V730A probably benign Het
Or2t44 T A 11: 58,677,063 (GRCm39) M1K probably null Het
Or51v14 T A 7: 103,261,386 (GRCm39) H58L probably damaging Het
Paqr6 C T 3: 88,275,205 (GRCm39) P213S probably damaging Het
Pign A T 1: 105,512,802 (GRCm39) V627D possibly damaging Het
Rasal1 T A 5: 120,797,685 (GRCm39) V139E probably damaging Het
Scgb1b24 G T 7: 33,443,577 (GRCm39) A79S possibly damaging Het
Slc25a28 T C 19: 43,653,031 (GRCm39) D210G probably benign Het
Slc38a3 A T 9: 107,532,353 (GRCm39) I393N possibly damaging Het
Slc41a2 T C 10: 83,090,790 (GRCm39) N465D probably damaging Het
Slc5a5 G A 8: 71,343,822 (GRCm39) T160I probably damaging Het
Smarca2 C T 19: 26,608,292 (GRCm39) A117V probably damaging Het
Sorcs2 C T 5: 36,219,931 (GRCm39) R371H probably damaging Het
Taf4 A G 2: 179,565,780 (GRCm39) S872P probably damaging Het
Tdrd3 G T 14: 87,743,690 (GRCm39) C540F probably benign Het
Thumpd1 A T 7: 119,319,897 (GRCm39) L23Q probably benign Het
Top1 A T 2: 160,540,061 (GRCm39) Y213F probably benign Het
Txndc5 T C 13: 38,712,160 (GRCm39) probably null Het
Unc79 C A 12: 103,108,991 (GRCm39) A2005D possibly damaging Het
Upb1 T C 10: 75,274,005 (GRCm39) L344P probably damaging Het
Vmn1r72 T A 7: 11,403,579 (GRCm39) S290C probably benign Het
Vmn2r103 A G 17: 20,013,866 (GRCm39) I219M possibly damaging Het
Wapl A G 14: 34,451,152 (GRCm39) T729A probably damaging Het
Washc5 C T 15: 59,227,783 (GRCm39) R393H probably damaging Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10,413,760 (GRCm39) missense probably damaging 1.00
IGL00503:Clec16a APN 16 10,512,513 (GRCm39) missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10,395,774 (GRCm39) missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10,395,774 (GRCm39) missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10,398,824 (GRCm39) missense probably damaging 1.00
IGL02082:Clec16a APN 16 10,432,432 (GRCm39) missense probably damaging 1.00
IGL02468:Clec16a APN 16 10,559,742 (GRCm39) missense probably benign 0.13
IGL02499:Clec16a APN 16 10,512,540 (GRCm39) missense probably benign 0.25
IGL02671:Clec16a APN 16 10,445,245 (GRCm39) missense probably benign 0.19
G5030:Clec16a UTSW 16 10,389,425 (GRCm39) missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10,559,645 (GRCm39) missense probably damaging 0.99
P0014:Clec16a UTSW 16 10,378,020 (GRCm39) splice site probably benign
R0183:Clec16a UTSW 16 10,377,886 (GRCm39) missense probably damaging 1.00
R0268:Clec16a UTSW 16 10,462,692 (GRCm39) nonsense probably null
R0512:Clec16a UTSW 16 10,432,444 (GRCm39) missense probably damaging 1.00
R0556:Clec16a UTSW 16 10,456,649 (GRCm39) critical splice acceptor site probably null
R0944:Clec16a UTSW 16 10,506,510 (GRCm39) splice site probably benign
R1456:Clec16a UTSW 16 10,509,419 (GRCm39) missense probably damaging 1.00
R1497:Clec16a UTSW 16 10,453,123 (GRCm39) missense probably damaging 1.00
R1580:Clec16a UTSW 16 10,413,762 (GRCm39) missense probably damaging 1.00
R1933:Clec16a UTSW 16 10,506,403 (GRCm39) missense probably damaging 0.99
R2075:Clec16a UTSW 16 10,559,480 (GRCm39) missense probably benign 0.09
R2269:Clec16a UTSW 16 10,462,650 (GRCm39) missense probably damaging 1.00
R2504:Clec16a UTSW 16 10,377,551 (GRCm39) intron probably benign
R3011:Clec16a UTSW 16 10,428,975 (GRCm39) missense probably benign 0.01
R4331:Clec16a UTSW 16 10,389,533 (GRCm39) missense probably benign
R4616:Clec16a UTSW 16 10,462,747 (GRCm39) critical splice donor site probably null
R4775:Clec16a UTSW 16 10,456,778 (GRCm39) missense probably damaging 1.00
R4969:Clec16a UTSW 16 10,386,375 (GRCm39) missense probably damaging 1.00
R5053:Clec16a UTSW 16 10,394,461 (GRCm39) missense probably damaging 1.00
R5170:Clec16a UTSW 16 10,559,655 (GRCm39) missense probably benign
R5329:Clec16a UTSW 16 10,549,543 (GRCm39) missense probably damaging 0.99
R5331:Clec16a UTSW 16 10,549,543 (GRCm39) missense probably damaging 0.99
R5332:Clec16a UTSW 16 10,549,543 (GRCm39) missense probably damaging 0.99
R5417:Clec16a UTSW 16 10,549,543 (GRCm39) missense probably damaging 0.99
R5419:Clec16a UTSW 16 10,549,543 (GRCm39) missense probably damaging 0.99
R5420:Clec16a UTSW 16 10,549,543 (GRCm39) missense probably damaging 0.99
R5457:Clec16a UTSW 16 10,363,396 (GRCm39) splice site probably null
R5623:Clec16a UTSW 16 10,428,985 (GRCm39) missense probably benign 0.07
R6057:Clec16a UTSW 16 10,447,951 (GRCm39) missense probably damaging 1.00
R6184:Clec16a UTSW 16 10,390,792 (GRCm39) splice site probably null
R6235:Clec16a UTSW 16 10,512,499 (GRCm39) missense probably damaging 1.00
R6260:Clec16a UTSW 16 10,512,712 (GRCm39) intron probably benign
R6318:Clec16a UTSW 16 10,448,652 (GRCm39) missense probably damaging 1.00
R6894:Clec16a UTSW 16 10,462,718 (GRCm39) missense probably damaging 1.00
R7340:Clec16a UTSW 16 10,398,827 (GRCm39) missense probably null 0.21
R7432:Clec16a UTSW 16 10,506,419 (GRCm39) missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10,462,686 (GRCm39) missense probably damaging 1.00
R7536:Clec16a UTSW 16 10,456,708 (GRCm39) missense possibly damaging 0.90
R8207:Clec16a UTSW 16 10,512,574 (GRCm39) missense probably damaging 1.00
R8207:Clec16a UTSW 16 10,445,312 (GRCm39) missense probably benign 0.00
R8423:Clec16a UTSW 16 10,394,527 (GRCm39) missense probably benign 0.04
R8447:Clec16a UTSW 16 10,559,487 (GRCm39) missense probably benign 0.09
R8700:Clec16a UTSW 16 10,506,422 (GRCm39) missense probably damaging 1.00
R8855:Clec16a UTSW 16 10,462,731 (GRCm39) missense probably damaging 1.00
R9143:Clec16a UTSW 16 10,428,964 (GRCm39) missense probably damaging 0.96
R9676:Clec16a UTSW 16 10,559,823 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTGAATGGGAAACTGGGCTAAC -3'
(R):5'- TTTGGCTTGCACCTCAACG -3'

Sequencing Primer
(F):5'- AACTTAACCACTGCTGTGTTGTGAG -3'
(R):5'- GTTCTCTCAAGGACGTTTGATACAG -3'
Posted On 2018-03-15