Incidental Mutation 'R6293:Gpr155'
ID508531
Institutional Source Beutler Lab
Gene Symbol Gpr155
Ensembl Gene ENSMUSG00000041762
Gene NameG protein-coupled receptor 155
SynonymsPGR22, 1110017O10Rik, DEPDC3, F730029F15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location73341506-73386572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73373997 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 158 (S158P)
Ref Sequence ENSEMBL: ENSMUSP00000107674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076463] [ENSMUST00000112043] [ENSMUST00000112044]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048504
SMART Domains Protein: ENSMUSP00000037772
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 1.9e-16 PFAM
Pfam:Mem_trans 187 360 4.9e-12 PFAM
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076463
AA Change: S158P

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075788
Gene: ENSMUSG00000041762
AA Change: S158P

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112043
AA Change: S158P

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107674
Gene: ENSMUSG00000041762
AA Change: S158P

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112044
AA Change: S158P

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107675
Gene: ENSMUSG00000041762
AA Change: S158P

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
Pfam:Mem_trans 187 360 8.3e-11 PFAM
transmembrane domain 382 404 N/A INTRINSIC
transmembrane domain 414 436 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
transmembrane domain 629 651 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
DEP 731 805 8.28e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184503
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Alkbh8 G T 9: 3,347,841 L211F possibly damaging Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gcnt2 T A 13: 40,918,697 V272D probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Ndel1 C T 11: 68,836,275 R192H probably damaging Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Olfr697 T C 7: 106,741,406 H176R probably damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prex2 A G 1: 11,162,298 N863S probably benign Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slc44a1 A G 4: 53,561,099 K605R probably damaging Het
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Gpr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gpr155 APN 2 73362613 missense probably damaging 1.00
IGL01432:Gpr155 APN 2 73351885 missense possibly damaging 0.51
IGL01528:Gpr155 APN 2 73362423 critical splice donor site probably null
IGL01718:Gpr155 APN 2 73382232 missense probably benign
IGL01733:Gpr155 APN 2 73353612 splice site probably null
IGL03342:Gpr155 APN 2 73349678 missense probably damaging 1.00
PIT1430001:Gpr155 UTSW 2 73370138 missense probably benign 0.08
PIT4810001:Gpr155 UTSW 2 73348263 missense probably benign 0.08
R0226:Gpr155 UTSW 2 73367592 missense probably benign 0.02
R0399:Gpr155 UTSW 2 73370002 missense possibly damaging 0.91
R0445:Gpr155 UTSW 2 73370144 splice site probably benign
R1570:Gpr155 UTSW 2 73370038 missense possibly damaging 0.87
R1598:Gpr155 UTSW 2 73370090 missense probably damaging 0.98
R1647:Gpr155 UTSW 2 73364164 splice site probably null
R1648:Gpr155 UTSW 2 73364164 splice site probably null
R1756:Gpr155 UTSW 2 73367577 missense probably benign 0.00
R1760:Gpr155 UTSW 2 73381935 missense probably damaging 1.00
R2033:Gpr155 UTSW 2 73348182 missense probably benign 0.18
R2044:Gpr155 UTSW 2 73373633 missense probably damaging 1.00
R2145:Gpr155 UTSW 2 73356658 missense probably benign 0.01
R2172:Gpr155 UTSW 2 73382127 missense probably benign 0.00
R2274:Gpr155 UTSW 2 73348135 critical splice donor site probably null
R3878:Gpr155 UTSW 2 73368392 nonsense probably null
R3924:Gpr155 UTSW 2 73370076 missense probably damaging 1.00
R4910:Gpr155 UTSW 2 73367538 nonsense probably null
R4950:Gpr155 UTSW 2 73382185 missense probably benign
R5337:Gpr155 UTSW 2 73348248 missense probably benign 0.32
R5830:Gpr155 UTSW 2 73370089 missense possibly damaging 0.93
R5887:Gpr155 UTSW 2 73343718 nonsense probably null
R5929:Gpr155 UTSW 2 73373667 nonsense probably null
R6553:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R6585:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R7003:Gpr155 UTSW 2 73343617 missense probably damaging 0.99
R7353:Gpr155 UTSW 2 73367491 nonsense probably null
R7506:Gpr155 UTSW 2 73368339 missense probably damaging 0.97
R7631:Gpr155 UTSW 2 73382947 intron probably benign
R7753:Gpr155 UTSW 2 73382206 missense probably benign 0.27
R7810:Gpr155 UTSW 2 73381952 missense probably damaging 0.99
R7813:Gpr155 UTSW 2 73381985 nonsense probably null
R7815:Gpr155 UTSW 2 73362560 missense probably benign
R7873:Gpr155 UTSW 2 73343590 missense possibly damaging 0.51
R8506:Gpr155 UTSW 2 73343462 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAACACGCGTAGAAATCCAAG -3'
(R):5'- GCTCCTGTCTGGAAACATAGTTACG -3'

Sequencing Primer
(F):5'- GAAATCCAAGTCCCACAATTTTTGC -3'
(R):5'- CCGGGTGGTACTTAATCTAGTATTTC -3'
Posted On2018-03-15