Mutagenetix > Incidental Mutation

Incidental Mutation 'R6293:Nup210l'

508538

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.403) question?

Stock #

R6293 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90115064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 113 (H113L)

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000029548
AA Change: H113L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: H113L

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200410
AA Change: H113L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: H113L

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Meta Mutation Damage Score

0.2884

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.4%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,141,746	D323G	probably damaging	Het
Abcb1b	T	C	5: 8,853,493	I1048T	probably benign	Het
Adgra3	G	A	5: 49,960,847	P1120S	probably benign	Het
Alkbh8	G	T	9: 3,347,841	L211F	possibly damaging	Het
Ankrd27	T	C	7: 35,608,460	S375P	possibly damaging	Het
Apoc1	T	A	7: 19,691,892	T68S	probably damaging	Het
Arfgef2	T	A	2: 166,873,588	Y1318N	possibly damaging	Het
Camsap2	C	A	1: 136,287,920	R345L	probably damaging	Het
Ccdc38	C	T	10: 93,562,797	Q46*	probably null	Het
Cdk12	T	A	11: 98,224,553	M840K	unknown	Het
Col12a1	A	T	9: 79,614,358	N2772K	probably benign	Het
Dthd1	A	G	5: 62,842,850	D505G	probably damaging	Het
Elf1	C	T	14: 79,560,786	H38Y	probably damaging	Het
Gcnt2	T	A	13: 40,918,697	V272D	probably damaging	Het
Gm9964	T	A	11: 79,296,594	K9M	unknown	Het
Gpr155	A	G	2: 73,373,997	S158P	possibly damaging	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Hmcn2	T	C	2: 31,335,451	I124T	probably damaging	Het
Hydin	A	G	8: 110,597,911	S4635G	possibly damaging	Het
Lrch2	C	T	X: 147,480,557	A369T	probably damaging	Homo
Lrrc8c	A	G	5: 105,606,746	Y129C	probably damaging	Het
Mbtd1	C	T	11: 93,932,232	H493Y	possibly damaging	Het
Mcm3ap	C	G	10: 76,471,478	Y418*	probably null	Het
Mpdz	A	G	4: 81,360,056	L764P	probably damaging	Het
Myt1l	A	G	12: 29,827,628	D426G	unknown	Het
Ndel1	C	T	11: 68,836,275	R192H	probably damaging	Het
Nudt21	T	C	8: 94,028,878	D134G	probably damaging	Het
Nxf1	A	G	19: 8,769,182	K586E	probably damaging	Het
Olfr1191-ps1	A	G	2: 88,643,280	E171G	possibly damaging	Het
Olfr697	T	C	7: 106,741,406	H176R	probably damaging	Het
Osbpl8	A	G	10: 111,272,238	Y365C	possibly damaging	Het
Pkd2l2	A	G	18: 34,427,444	Y368C	probably damaging	Het
Pkn2	A	G	3: 142,809,704	F649L	probably benign	Het
Pla2g4a	T	C	1: 149,880,047	Y205C	probably damaging	Het
Prex2	A	G	1: 11,162,298	N863S	probably benign	Het
Prkdc	A	G	16: 15,787,155	K2979R	probably benign	Het
Ptk6	T	C	2: 181,198,460	Y251C	probably damaging	Het
Rapgef6	T	A	11: 54,634,781	W334R	probably damaging	Het
Rbm11	A	T	16: 75,596,767		probably null	Het
Rhbdl1	A	G	17: 25,834,969	L309P	probably damaging	Het
Rhbg	G	A	3: 88,245,826	R274*	probably null	Het
Rpp30	A	G	19: 36,104,445	*269W	probably null	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Homo
Slc44a1	A	G	4: 53,561,099	K605R	probably damaging	Het
Slco2a1	A	G	9: 103,050,147	S80G	probably benign	Het
Tmem50b	A	T	16: 91,583,276	M71K	probably damaging	Het
Ttn	G	A	2: 76,749,329	T23740M	probably damaging	Het
Tyro3	A	G	2: 119,808,000	T303A	possibly damaging	Het
Uba3	A	T	6: 97,196,908	D105E	probably damaging	Het
Vmn1r21	T	C	6: 57,844,270	D63G	probably benign	Het
Vstm2b	T	A	7: 40,900,109	I63N	probably damaging	Het
Wdr66	A	C	5: 123,322,448	N1158H	probably damaging	Het
Ylpm1	C	G	12: 85,015,277	P651A	unknown	Het
Zscan22	T	A	7: 12,906,907	C359*	probably null	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTACATAGGTCTGGCTGCAG -3'
(R):5'- GGAACAACACTCCATGTCAGG -3'

Sequencing Primer
(F):5'- GATCCCCTGCATCTAGGATTATAGG -3'
(R):5'- AGGCACTGCTTACTCAAGTCG -3'

Posted On

2018-03-15