Incidental Mutation 'R6293:Haus5'
ID508552
Institutional Source Beutler Lab
Gene Symbol Haus5
Ensembl Gene ENSMUSG00000078762
Gene NameHAUS augmin-like complex, subunit 5
Synonyms2310022K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30653711-30664994 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 30658976 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 298 (W298*)
Ref Sequence ENSEMBL: ENSMUSP00000121739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019697] [ENSMUST00000132862]
Predicted Effect probably null
Transcript: ENSMUST00000019697
AA Change: W298*
SMART Domains Protein: ENSMUSP00000019697
Gene: ENSMUSG00000078762
AA Change: W298*

DomainStartEndE-ValueType
Pfam:HAUS5 7 617 9.8e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126511
Predicted Effect probably null
Transcript: ENSMUST00000132862
AA Change: W298*
SMART Domains Protein: ENSMUSP00000121739
Gene: ENSMUSG00000078762
AA Change: W298*

DomainStartEndE-ValueType
Pfam:HAUS5 5 515 4.4e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146232
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HAUS5 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]; Uehara et al., 2009 [PubMed 19369198]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Alkbh8 G T 9: 3,347,841 L211F possibly damaging Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gcnt2 T A 13: 40,918,697 V272D probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Gpr155 A G 2: 73,373,997 S158P possibly damaging Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Ndel1 C T 11: 68,836,275 R192H probably damaging Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Olfr697 T C 7: 106,741,406 H176R probably damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prex2 A G 1: 11,162,298 N863S probably benign Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slc44a1 A G 4: 53,561,099 K605R probably damaging Het
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Haus5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Haus5 APN 7 30663294 splice site probably benign
IGL02422:Haus5 APN 7 30660146 missense possibly damaging 0.95
IGL02427:Haus5 APN 7 30661771 missense probably benign
IGL02626:Haus5 APN 7 30657250 missense probably damaging 1.00
IGL02695:Haus5 APN 7 30663277 missense probably damaging 1.00
R0046:Haus5 UTSW 7 30654180 missense probably benign 0.10
R0046:Haus5 UTSW 7 30654180 missense probably benign 0.10
R0511:Haus5 UTSW 7 30659067 missense probably damaging 1.00
R0547:Haus5 UTSW 7 30659083 missense probably damaging 0.96
R1447:Haus5 UTSW 7 30661791 splice site probably null
R1711:Haus5 UTSW 7 30657903 nonsense probably null
R1852:Haus5 UTSW 7 30658501 critical splice donor site probably null
R1901:Haus5 UTSW 7 30657245 missense probably damaging 1.00
R2029:Haus5 UTSW 7 30659400 missense possibly damaging 0.95
R4832:Haus5 UTSW 7 30657027 missense probably damaging 0.97
R4865:Haus5 UTSW 7 30658555 missense probably damaging 1.00
R5123:Haus5 UTSW 7 30654226 missense probably benign 0.23
R5168:Haus5 UTSW 7 30657711 missense possibly damaging 0.95
R5492:Haus5 UTSW 7 30658955 missense possibly damaging 0.69
R6296:Haus5 UTSW 7 30658976 nonsense probably null
R6297:Haus5 UTSW 7 30658976 nonsense probably null
R6332:Haus5 UTSW 7 30658976 nonsense probably null
R6334:Haus5 UTSW 7 30658976 nonsense probably null
R6964:Haus5 UTSW 7 30657615 missense probably benign 0.41
R7095:Haus5 UTSW 7 30659572 missense probably benign 0.06
R7348:Haus5 UTSW 7 30656966 missense possibly damaging 0.94
U24488:Haus5 UTSW 7 30658976 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCCCAGAGTAGACAACATTCAG -3'
(R):5'- ACTGAATGCCAGCCAGTCAC -3'

Sequencing Primer
(F):5'- GAGTAGACAACATTCAGTATCCCCAG -3'
(R):5'- AGGGAACACTGATATTGACTACC -3'
Posted On2018-03-15