Incidental Mutation 'R6293:Olfr697'
ID508556
Institutional Source Beutler Lab
Gene Symbol Olfr697
Ensembl Gene ENSMUSG00000051591
Gene Nameolfactory receptor 697
SynonymsGA_x6K02T2PBJ9-9119301-9118348, MOR283-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106740834-106742443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106741406 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 176 (H176R)
Ref Sequence ENSEMBL: ENSMUSP00000152039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050541] [ENSMUST00000217734]
Predicted Effect probably damaging
Transcript: ENSMUST00000050541
AA Change: H176R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055207
Gene: ENSMUSG00000051591
AA Change: H176R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.7e-7 PFAM
Pfam:7tm_1 41 290 8.7e-26 PFAM
Pfam:7TM_GPCR_Srx 69 306 4.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217734
AA Change: H176R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Alkbh8 G T 9: 3,347,841 L211F possibly damaging Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gcnt2 T A 13: 40,918,697 V272D probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Gpr155 A G 2: 73,373,997 S158P possibly damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Ndel1 C T 11: 68,836,275 R192H probably damaging Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prex2 A G 1: 11,162,298 N863S probably benign Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slc44a1 A G 4: 53,561,099 K605R probably damaging Het
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Olfr697
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr697 APN 7 106741701 missense probably benign 0.20
IGL00937:Olfr697 APN 7 106741157 missense probably damaging 1.00
IGL01368:Olfr697 APN 7 106741622 missense probably benign 0.19
IGL01410:Olfr697 APN 7 106741499 missense probably benign 0.19
IGL01415:Olfr697 APN 7 106741499 missense probably benign 0.19
IGL01962:Olfr697 APN 7 106741784 missense probably benign 0.12
IGL02654:Olfr697 APN 7 106741348 nonsense probably null
IGL02903:Olfr697 APN 7 106741710 missense probably damaging 1.00
IGL03347:Olfr697 APN 7 106740970 utr 3 prime probably benign
IGL03391:Olfr697 APN 7 106741755 missense probably damaging 1.00
R0139:Olfr697 UTSW 7 106741625 missense probably benign 0.05
R0142:Olfr697 UTSW 7 106741765 missense probably benign 0.36
R1293:Olfr697 UTSW 7 106741851 missense probably damaging 0.98
R1522:Olfr697 UTSW 7 106741005 missense probably benign 0.03
R1715:Olfr697 UTSW 7 106741548 missense probably damaging 1.00
R1959:Olfr697 UTSW 7 106741394 missense probably damaging 1.00
R1960:Olfr697 UTSW 7 106741394 missense probably damaging 1.00
R2031:Olfr697 UTSW 7 106741898 missense probably damaging 1.00
R4790:Olfr697 UTSW 7 106741791 missense probably benign 0.05
R5550:Olfr697 UTSW 7 106741133 missense probably benign 0.01
R6232:Olfr697 UTSW 7 106741554 missense probably damaging 0.96
R6643:Olfr697 UTSW 7 106741704 missense probably benign 0.06
R7831:Olfr697 UTSW 7 106741413 missense probably damaging 0.99
R7914:Olfr697 UTSW 7 106741413 missense probably damaging 0.99
R8013:Olfr697 UTSW 7 106741617 missense probably benign 0.00
R8014:Olfr697 UTSW 7 106741617 missense probably benign 0.00
RF018:Olfr697 UTSW 7 106741485 missense probably benign 0.02
X0020:Olfr697 UTSW 7 106741136 missense probably damaging 0.97
Z1088:Olfr697 UTSW 7 106741143 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AACAGGTAACAAGGGCTTTCTTC -3'
(R):5'- TGGTGCAGAGGACCTTCTTC -3'

Sequencing Primer
(F):5'- CCTGCTCTCATTTGAAGGCATGTG -3'
(R):5'- CAGAGGACCTTCTTCTGGCTTTTATG -3'
Posted On2018-03-15