Incidental Mutation 'R6293:Alkbh8'
ID508559
Institutional Source Beutler Lab
Gene Symbol Alkbh8
Ensembl Gene ENSMUSG00000025899
Gene NamealkB homolog 8, tRNA methyltransferase
Synonyms4930562C03Rik, Abh8, 9430088N01Rik, 8030431D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location3335140-3391154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3347841 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 211 (L211F)
Ref Sequence ENSEMBL: ENSMUSP00000148653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053407] [ENSMUST00000165105] [ENSMUST00000211933] [ENSMUST00000212154] [ENSMUST00000212294] [ENSMUST00000212358] [ENSMUST00000212666] [ENSMUST00000212817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053407
AA Change: L211F

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061511
Gene: ENSMUSG00000025899
AA Change: L211F

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 8.7e-27 PFAM
Pfam:2OG-FeII_Oxy 220 336 1.8e-11 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_23 386 534 1e-9 PFAM
Pfam:Methyltransf_31 404 547 3.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.7e-9 PFAM
Pfam:Methyltransf_11 411 501 5.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083022
Predicted Effect possibly damaging
Transcript: ENSMUST00000165105
AA Change: L211F

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125996
Gene: ENSMUSG00000025899
AA Change: L211F

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 1.6e-24 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.5e-9 PFAM
Pfam:Methyltransf_11 411 501 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211884
Predicted Effect possibly damaging
Transcript: ENSMUST00000211933
AA Change: L211F

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000212154
Predicted Effect probably benign
Transcript: ENSMUST00000212294
Predicted Effect probably benign
Transcript: ENSMUST00000212358
Predicted Effect probably benign
Transcript: ENSMUST00000212666
Predicted Effect probably benign
Transcript: ENSMUST00000212817
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous mutants show no obvious phenotype at 20 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gcnt2 T A 13: 40,918,697 V272D probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Gpr155 A G 2: 73,373,997 S158P possibly damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Ndel1 C T 11: 68,836,275 R192H probably damaging Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Olfr697 T C 7: 106,741,406 H176R probably damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prex2 A G 1: 11,162,298 N863S probably benign Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slc44a1 A G 4: 53,561,099 K605R probably damaging Het
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Alkbh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Alkbh8 APN 9 3359588 missense probably damaging 1.00
IGL01419:Alkbh8 APN 9 3385354 missense probably damaging 1.00
IGL01457:Alkbh8 APN 9 3369825 missense probably damaging 1.00
IGL02398:Alkbh8 APN 9 3345870 missense possibly damaging 0.77
IGL02503:Alkbh8 APN 9 3347852 missense probably damaging 1.00
IGL02824:Alkbh8 APN 9 3368021 splice site probably null
IGL03001:Alkbh8 APN 9 3344602 missense probably benign
IGL03055:Alkbh8 APN 9 3345882 splice site probably benign
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0403:Alkbh8 UTSW 9 3385469 missense probably damaging 1.00
R1331:Alkbh8 UTSW 9 3347916 unclassified probably null
R1688:Alkbh8 UTSW 9 3382765 missense probably damaging 1.00
R1859:Alkbh8 UTSW 9 3385499 missense probably benign 0.07
R2014:Alkbh8 UTSW 9 3343216 nonsense probably null
R3016:Alkbh8 UTSW 9 3369658 missense probably benign 0.08
R3722:Alkbh8 UTSW 9 3385153 missense probably damaging 1.00
R4744:Alkbh8 UTSW 9 3344604 nonsense probably null
R4840:Alkbh8 UTSW 9 3369751 missense probably damaging 1.00
R5403:Alkbh8 UTSW 9 3385318 missense probably benign 0.00
R5644:Alkbh8 UTSW 9 3385384 missense probably damaging 1.00
R5677:Alkbh8 UTSW 9 3385147 missense possibly damaging 0.93
R5902:Alkbh8 UTSW 9 3385414 missense probably benign 0.04
R7352:Alkbh8 UTSW 9 3345796 missense probably damaging 0.99
R7457:Alkbh8 UTSW 9 3343056 missense probably damaging 0.99
R7869:Alkbh8 UTSW 9 3359503 missense probably damaging 1.00
R7887:Alkbh8 UTSW 9 3385343 missense probably damaging 0.99
R7952:Alkbh8 UTSW 9 3359503 missense probably damaging 1.00
R7970:Alkbh8 UTSW 9 3385343 missense probably damaging 0.99
R8052:Alkbh8 UTSW 9 3385478 missense probably damaging 1.00
X0028:Alkbh8 UTSW 9 3369767 missense probably benign 0.01
X0062:Alkbh8 UTSW 9 3359532 missense probably null 1.00
Z1176:Alkbh8 UTSW 9 3345820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCCTGAGGTGTAAGGTATTATG -3'
(R):5'- GCACTAGCTACTCTATCAGTGG -3'

Sequencing Primer
(F):5'- TTTGGATAAGGGCAATGCAATGTG -3'
(R):5'- ACCATGCCCAGGTTCATA -3'
Posted On2018-03-15