Incidental Mutation 'R6293:Gcnt2'
ID508572
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Nameglucosaminyl (N-acetyl) transferase 2, I-branching enzyme
SynonymsIGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location40859754-40960892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40918697 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 272 (V272D)
Ref Sequence ENSEMBL: ENSMUSP00000153207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000225759]
Predicted Effect probably damaging
Transcript: ENSMUST00000067778
AA Change: V272D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360
AA Change: V272D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Branch 95 357 4.2e-58 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069958
SMART Domains Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Branch 95 357 8.4e-60 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110191
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224935
Predicted Effect probably damaging
Transcript: ENSMUST00000225759
AA Change: V272D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Alkbh8 G T 9: 3,347,841 L211F possibly damaging Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Gpr155 A G 2: 73,373,997 S158P possibly damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Ndel1 C T 11: 68,836,275 R192H probably damaging Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Olfr697 T C 7: 106,741,406 H176R probably damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prex2 A G 1: 11,162,298 N863S probably benign Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slc44a1 A G 4: 53,561,099 K605R probably damaging Het
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
BB001:Gcnt2 UTSW 13 40918564 nonsense probably null
BB011:Gcnt2 UTSW 13 40918564 nonsense probably null
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4618:Gcnt2 UTSW 13 40958194 nonsense probably null
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 40860719 missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5493:Gcnt2 UTSW 13 40953600 missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7077:Gcnt2 UTSW 13 40860420 missense probably benign
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
R7599:Gcnt2 UTSW 13 40860867 nonsense probably null
R7678:Gcnt2 UTSW 13 40953719 missense probably benign 0.01
R7806:Gcnt2 UTSW 13 40918241 missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 40860862 missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 40860450 missense probably benign 0.00
R7924:Gcnt2 UTSW 13 40918564 nonsense probably null
R8110:Gcnt2 UTSW 13 40917722 start gained probably benign
R8287:Gcnt2 UTSW 13 40860632 missense probably damaging 1.00
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTCCTCAACACCTGCG -3'
(R):5'- CCATTTGCAATCTACAAAGAAAGACGG -3'

Sequencing Primer
(F):5'- GGGCAGGACTTCCCTTTGAAAAC -3'
(R):5'- ATCTACAAAGAAAGACGGAGTAAAC -3'
Posted On2018-03-15