Mutagenetix > Incidental Mutations

Incidental Mutation 'R6294:Cat'

508585

Institutional Source

Beutler Lab

Gene Symbol

Cat

Ensembl Gene

ENSMUSG00000027187

Gene Name

catalase

Synonyms

Cas1, Cas-1, Cs-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6294 (G1)

Quality Score

211.009

Status

Validated

Chromosome

Chromosomal Location

103453849-103485160 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103460295 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 425 (C425S)

Ref Sequence

ENSEMBL: ENSMUSP00000028610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028610] [ENSMUST00000111168]

Predicted Effect

probably benign
Transcript: ENSMUST00000028610
AA Change: C425S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028610
Gene: ENSMUSG00000027187
AA Change: C425S

Domain	Start	End	E-Value	Type
Catalase	28	413	4.7e-285	SMART
Pfam:Catalase-rel	434	497	5.8e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111168

SMART Domains

Protein: ENSMUSP00000106798
Gene: ENSMUSG00000027187

Domain	Start	End	E-Value	Type
Catalase	28	176	2.33e-3	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype although subtle abnormalities do occur in mitochondrial respiration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,654,481	H579L	probably benign	Het
Aldh2	G	A	5: 121,572,816	Q8*	probably null	Het
Ankdd1a	G	T	9: 65,520,164	H10Q	probably benign	Het
Arpp21	A	G	9: 112,127,452	F453L	probably damaging	Het
Birc6	C	A	17: 74,689,257	D4461E	probably benign	Het
Cacna1b	A	T	2: 24,719,057	S411T	possibly damaging	Het
Camk2g	A	G	14: 20,764,949	I203T	probably damaging	Het
Ccdc34	A	G	2: 110,018,151	D95G	probably benign	Het
Clca4b	T	C	3: 144,925,185	S305G	probably null	Het
Cul7	T	C	17: 46,663,148	I1453T	probably benign	Het
Dlg1	T	A	16: 31,838,124	I612N	probably damaging	Het
Dync2h1	T	G	9: 7,084,986	K561T	probably benign	Het
Erbin	T	C	13: 103,857,056	T359A	probably benign	Het
Far2	T	A	6: 148,157,482	L222Q	probably damaging	Het
Fbxw17	A	G	13: 50,423,803	E114G	probably benign	Het
Fryl	A	T	5: 73,191,759		probably benign	Het
Ggn	A	G	7: 29,173,848	D666G	possibly damaging	Het
Hal	G	A	10: 93,514,143		probably null	Het
Htt	A	G	5: 34,821,826	D851G	probably benign	Het
Ighv14-2	A	T	12: 113,994,598	D74E	probably benign	Het
Igkv5-43	G	A	6: 69,823,442	S87L	probably damaging	Het
Klhl29	A	T	12: 5,083,995	F720I	probably damaging	Het
Klk1b8	T	A	7: 43,952,772	Y43N	probably damaging	Het
Krtap6-3	T	A	16: 89,084,101	Y7N	unknown	Het
Lama4	T	A	10: 39,075,470	F1070L	probably damaging	Het
Map4	A	G	9: 110,002,746	E98G	possibly damaging	Het
Mbtd1	C	T	11: 93,932,232	H493Y	possibly damaging	Het
Mki67	A	G	7: 135,704,590	M581T	probably benign	Het
Mtss1l	T	A	8: 110,727,328	N43K	possibly damaging	Het
Mylk3	T	A	8: 85,350,383	I475F	probably damaging	Het
Nat14	C	T	7: 4,924,074	R82*	probably null	Het
Nckap1	T	C	2: 80,541,514	N324S	probably benign	Het
Nemp1	C	T	10: 127,694,522	T281M	possibly damaging	Het
Nrg3	A	T	14: 38,397,239	H425Q	probably benign	Het
Olfr101	T	A	17: 37,299,553	T290S	probably benign	Het
Olfr1318	A	G	2: 112,156,019	I23V	probably benign	Het
Olfr1487	T	C	19: 13,619,366	V25A	probably benign	Het
Olfr584	A	T	7: 103,085,667	I45F	probably benign	Het
Olfr622	A	G	7: 103,639,591	M183T	probably damaging	Het
Olfr95	T	C	17: 37,211,626	T76A	probably benign	Het
Omd	T	A	13: 49,589,991	N172K	probably damaging	Het
Orc1	T	C	4: 108,590,670	I38T	probably benign	Het
Oxct1	A	G	15: 4,142,822	T457A	possibly damaging	Het
Pcdh17	A	T	14: 84,477,668	K924N	probably benign	Het
Pkhd1l1	A	T	15: 44,570,028	I3435F	probably damaging	Het
Psg20	C	A	7: 18,682,679	V171F	probably damaging	Het
Rab11fip2	A	T	19: 59,937,099	S87T	probably damaging	Het
Rabgap1l	T	C	1: 160,231,849	T237A	probably benign	Het
Rasgrp1	A	T	2: 117,291,792	Y372*	probably null	Het
Rell1	G	T	5: 63,939,705		probably benign	Het
Rps14	A	G	18: 60,776,961	K61E	possibly damaging	Het
Rtl6	A	G	15: 84,557,120	V25A	possibly damaging	Het
Ryr2	G	T	13: 11,879,496	S185R	probably damaging	Het
Slc10a2	C	T	8: 5,091,621		probably null	Het
Slc14a1	T	A	18: 78,110,058		probably null	Het
Smad2	A	T	18: 76,289,162	N215I	probably benign	Het
Smchd1	A	T	17: 71,370,927	N1473K	probably benign	Het
Spag9	A	G	11: 94,093,485		probably null	Het
Stk31	A	C	6: 49,417,344	R213S	probably benign	Het
Tmod4	A	T	3: 95,128,306	Q255L	probably benign	Het
Tnpo1	T	A	13: 98,890,774	Y3F	probably benign	Het
Tom1l1	A	C	11: 90,661,761	Y206*	probably null	Het
Tulp2	A	G	7: 45,514,692	K36E	probably damaging	Het
Tulp4	C	T	17: 6,201,819	R282C	probably damaging	Het
Unc5b	A	T	10: 60,778,331	N246K	possibly damaging	Het
Ush2a	C	G	1: 188,536,370	S1674R	possibly damaging	Het
Vmn1r224	T	C	17: 20,419,821	I220T	probably benign	Het
Vmn1r7	G	C	6: 57,024,419	N285K	probably benign	Het
Vmn2r83	C	T	10: 79,477,854	P99S	probably damaging	Het
Zbtb38	A	G	9: 96,687,229	F601L	probably benign	Het
Zc3h3	A	T	15: 75,809,568	S555T	possibly damaging	Het

Other mutations in Cat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02989:Cat	APN	2	103472973	missense	probably damaging	1.00
PIT4696001:Cat	UTSW	2	103471812	missense	probably damaging	0.99
R1968:Cat	UTSW	2	103484989	missense	probably benign	0.01
R2103:Cat	UTSW	2	103463315	missense	probably damaging	1.00
R2655:Cat	UTSW	2	103471846	missense	probably damaging	1.00
R3037:Cat	UTSW	2	103467777	missense	probably benign	0.07
R5287:Cat	UTSW	2	103474360	missense	probably damaging	1.00
R5527:Cat	UTSW	2	103472973	missense	probably damaging	1.00
R5694:Cat	UTSW	2	103472994	missense	probably damaging	1.00
R6089:Cat	UTSW	2	103472951	missense	probably null	0.48
R6177:Cat	UTSW	2	103473075	missense	probably damaging	1.00
R6281:Cat	UTSW	2	103471769	missense	probably damaging	1.00
R7058:Cat	UTSW	2	103474353	missense	probably benign	0.31
R7274:Cat	UTSW	2	103476890	missense	probably benign	0.07
R7347:Cat	UTSW	2	103463298	missense	probably benign
R7654:Cat	UTSW	2	103460364	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACCTTAAGAAGTGGCCAG -3'
(R):5'- ATTTCCCAGCATGTGATGTGTTTAC -3'

Sequencing Primer
(F):5'- GCCTTTAGTCCCAGAACTTGAGAG -3'
(R):5'- ACATCGGTGCCTGATGTATG -3'

Posted On

2018-03-15