Mutagenetix > Incidental Mutations

Incidental Mutation 'R6294:Rasgrp1'

508588

Institutional Source

Beutler Lab

Gene Symbol

Rasgrp1

Ensembl Gene

ENSMUSG00000027347

Gene Name

RAS guanyl releasing protein 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.218) question?

Stock #

R6294 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

117279993-117343001 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 117291792 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 372 (Y372*)

Ref Sequence

ENSEMBL: ENSMUSP00000136423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102534] [ENSMUST00000172901] [ENSMUST00000173252] [ENSMUST00000173541] [ENSMUST00000174770] [ENSMUST00000178884]

Predicted Effect

probably null
Transcript: ENSMUST00000102534
AA Change: Y372*

SMART Domains

Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: Y372*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
Pfam:EF-hand_6	474	502	5e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000172901
AA Change: Y372*

SMART Domains

Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347
AA Change: Y372*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.2e-5	PFAM
C1	507	556	5.77e-16	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000173252
AA Change: Y372*

SMART Domains

Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347
AA Change: Y372*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.1e-5	PFAM
Pfam:C1_1	507	539	3.4e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000173541
AA Change: Y372*

SMART Domains

Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: Y372*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	441	464	1.6e-5	PFAM
Pfam:EF-hand_6	442	467	1.6e-5	PFAM
C1	507	556	5.77e-16	SMART
PDB:4L9U\|B	705	756	2e-23	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000174770
AA Change: Y372*

SMART Domains

Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347
AA Change: Y372*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000178884
AA Change: Y372*

SMART Domains

Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: Y372*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,654,481	H579L	probably benign	Het
Aldh2	G	A	5: 121,572,816	Q8*	probably null	Het
Ankdd1a	G	T	9: 65,520,164	H10Q	probably benign	Het
Arpp21	A	G	9: 112,127,452	F453L	probably damaging	Het
Birc6	C	A	17: 74,689,257	D4461E	probably benign	Het
Cacna1b	A	T	2: 24,719,057	S411T	possibly damaging	Het
Camk2g	A	G	14: 20,764,949	I203T	probably damaging	Het
Cat	A	T	2: 103,460,295	C425S	probably benign	Het
Ccdc34	A	G	2: 110,018,151	D95G	probably benign	Het
Clca4b	T	C	3: 144,925,185	S305G	probably null	Het
Cul7	T	C	17: 46,663,148	I1453T	probably benign	Het
Dlg1	T	A	16: 31,838,124	I612N	probably damaging	Het
Dync2h1	T	G	9: 7,084,986	K561T	probably benign	Het
Erbin	T	C	13: 103,857,056	T359A	probably benign	Het
Far2	T	A	6: 148,157,482	L222Q	probably damaging	Het
Fbxw17	A	G	13: 50,423,803	E114G	probably benign	Het
Fryl	A	T	5: 73,191,759		probably benign	Het
Ggn	A	G	7: 29,173,848	D666G	possibly damaging	Het
Hal	G	A	10: 93,514,143		probably null	Het
Htt	A	G	5: 34,821,826	D851G	probably benign	Het
Ighv14-2	A	T	12: 113,994,598	D74E	probably benign	Het
Igkv5-43	G	A	6: 69,823,442	S87L	probably damaging	Het
Klhl29	A	T	12: 5,083,995	F720I	probably damaging	Het
Klk1b8	T	A	7: 43,952,772	Y43N	probably damaging	Het
Krtap6-3	T	A	16: 89,084,101	Y7N	unknown	Het
Lama4	T	A	10: 39,075,470	F1070L	probably damaging	Het
Map4	A	G	9: 110,002,746	E98G	possibly damaging	Het
Mbtd1	C	T	11: 93,932,232	H493Y	possibly damaging	Het
Mki67	A	G	7: 135,704,590	M581T	probably benign	Het
Mtss1l	T	A	8: 110,727,328	N43K	possibly damaging	Het
Mylk3	T	A	8: 85,350,383	I475F	probably damaging	Het
Nat14	C	T	7: 4,924,074	R82*	probably null	Het
Nckap1	T	C	2: 80,541,514	N324S	probably benign	Het
Nemp1	C	T	10: 127,694,522	T281M	possibly damaging	Het
Nrg3	A	T	14: 38,397,239	H425Q	probably benign	Het
Olfr101	T	A	17: 37,299,553	T290S	probably benign	Het
Olfr1318	A	G	2: 112,156,019	I23V	probably benign	Het
Olfr1487	T	C	19: 13,619,366	V25A	probably benign	Het
Olfr584	A	T	7: 103,085,667	I45F	probably benign	Het
Olfr622	A	G	7: 103,639,591	M183T	probably damaging	Het
Olfr95	T	C	17: 37,211,626	T76A	probably benign	Het
Omd	T	A	13: 49,589,991	N172K	probably damaging	Het
Orc1	T	C	4: 108,590,670	I38T	probably benign	Het
Oxct1	A	G	15: 4,142,822	T457A	possibly damaging	Het
Pcdh17	A	T	14: 84,477,668	K924N	probably benign	Het
Pkhd1l1	A	T	15: 44,570,028	I3435F	probably damaging	Het
Psg20	C	A	7: 18,682,679	V171F	probably damaging	Het
Rab11fip2	A	T	19: 59,937,099	S87T	probably damaging	Het
Rabgap1l	T	C	1: 160,231,849	T237A	probably benign	Het
Rell1	G	T	5: 63,939,705		probably benign	Het
Rps14	A	G	18: 60,776,961	K61E	possibly damaging	Het
Rtl6	A	G	15: 84,557,120	V25A	possibly damaging	Het
Ryr2	G	T	13: 11,879,496	S185R	probably damaging	Het
Slc10a2	C	T	8: 5,091,621		probably null	Het
Slc14a1	T	A	18: 78,110,058		probably null	Het
Smad2	A	T	18: 76,289,162	N215I	probably benign	Het
Smchd1	A	T	17: 71,370,927	N1473K	probably benign	Het
Spag9	A	G	11: 94,093,485		probably null	Het
Stk31	A	C	6: 49,417,344	R213S	probably benign	Het
Tmod4	A	T	3: 95,128,306	Q255L	probably benign	Het
Tnpo1	T	A	13: 98,890,774	Y3F	probably benign	Het
Tom1l1	A	C	11: 90,661,761	Y206*	probably null	Het
Tulp2	A	G	7: 45,514,692	K36E	probably damaging	Het
Tulp4	C	T	17: 6,201,819	R282C	probably damaging	Het
Unc5b	A	T	10: 60,778,331	N246K	possibly damaging	Het
Ush2a	C	G	1: 188,536,370	S1674R	possibly damaging	Het
Vmn1r224	T	C	17: 20,419,821	I220T	probably benign	Het
Vmn1r7	G	C	6: 57,024,419	N285K	probably benign	Het
Vmn2r83	C	T	10: 79,477,854	P99S	probably damaging	Het
Zbtb38	A	G	9: 96,687,229	F601L	probably benign	Het
Zc3h3	A	T	15: 75,809,568	S555T	possibly damaging	Het

Other mutations in Rasgrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Rasgrp1	APN	2	117305791	nonsense	probably null
IGL00901:Rasgrp1	APN	2	117285130	missense	probably damaging	0.96
IGL01083:Rasgrp1	APN	2	117285068	missense	probably benign	0.22
IGL01325:Rasgrp1	APN	2	117298529	missense	probably damaging	1.00
IGL01520:Rasgrp1	APN	2	117288663	missense	probably damaging	1.00
IGL01776:Rasgrp1	APN	2	117286840	critical splice donor site	probably null
IGL01780:Rasgrp1	APN	2	117284878	missense	probably benign	0.00
IGL01859:Rasgrp1	APN	2	117289418	missense	probably benign	0.00
IGL01892:Rasgrp1	APN	2	117293842	missense	probably damaging	1.00
IGL02068:Rasgrp1	APN	2	117300578	splice site	probably benign
IGL02684:Rasgrp1	APN	2	117282576	missense	probably benign	0.03
bukhansan	UTSW	2	117291697	missense	possibly damaging	0.78
grouper	UTSW	2	117302004	nonsense	probably null
Gyeryandsan	UTSW	2	117287943	missense	probably damaging	1.00
Haddock	UTSW	2	117291895	missense	probably damaging	0.99
mercurial	UTSW	2	117287833	nonsense	probably null
naejangsan	UTSW	2	117291792	nonsense	probably null
sea_bass	UTSW	2	117282654	missense	probably benign	0.02
venutian	UTSW	2	117284929	nonsense	probably null
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0538:Rasgrp1	UTSW	2	117284947	missense	probably benign	0.42
R0786:Rasgrp1	UTSW	2	117300499	missense	probably benign
R1068:Rasgrp1	UTSW	2	117282576	missense	probably benign	0.03
R1165:Rasgrp1	UTSW	2	117284939	missense	possibly damaging	0.49
R1491:Rasgrp1	UTSW	2	117282619	nonsense	probably null
R1707:Rasgrp1	UTSW	2	117298547	missense	probably damaging	1.00
R1869:Rasgrp1	UTSW	2	117290347	missense	probably damaging	1.00
R2214:Rasgrp1	UTSW	2	117285165	missense	probably damaging	0.98
R2425:Rasgrp1	UTSW	2	117289450	critical splice acceptor site	probably null
R3236:Rasgrp1	UTSW	2	117291812	missense	probably benign	0.00
R3915:Rasgrp1	UTSW	2	117288641	missense	probably damaging	1.00
R4079:Rasgrp1	UTSW	2	117285029	missense	probably benign	0.19
R4163:Rasgrp1	UTSW	2	117282654	missense	probably benign	0.02
R4781:Rasgrp1	UTSW	2	117291709	missense	probably benign	0.04
R4782:Rasgrp1	UTSW	2	117284875	missense	probably benign	0.00
R5028:Rasgrp1	UTSW	2	117302004	nonsense	probably null
R6019:Rasgrp1	UTSW	2	117291895	missense	probably damaging	0.99
R6220:Rasgrp1	UTSW	2	117284929	nonsense	probably null
R6335:Rasgrp1	UTSW	2	117293870	missense	probably damaging	0.99
R6948:Rasgrp1	UTSW	2	117298604	missense	probably damaging	0.99
R7165:Rasgrp1	UTSW	2	117338404	missense	probably benign	0.02
R7246:Rasgrp1	UTSW	2	117338354	nonsense	probably null
R7372:Rasgrp1	UTSW	2	117285154	missense	probably benign	0.01
R7400:Rasgrp1	UTSW	2	117298545	missense	probably damaging	1.00
R7432:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117291697	missense	possibly damaging	0.78
R7449:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7450:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7475:Rasgrp1	UTSW	2	117286108	missense	probably benign
R7487:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7573:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7672:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R8016:Rasgrp1	UTSW	2	117287833	nonsense	probably null
R8199:Rasgrp1	UTSW	2	117293812	missense	probably damaging	1.00
R8527:Rasgrp1	UTSW	2	117338304	missense	probably benign	0.07
Z1176:Rasgrp1	UTSW	2	117301974	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATGAGAAGGAAAGCAGAATCCTCC -3'
(R):5'- CCAGTGACCGATCTGTTCTG -3'

Sequencing Primer
(F):5'- GGAAAGCAGAATCCTCCCTCCTC -3'
(R):5'- CAGTGACCGATCTGTTCTGCTTTG -3'

Posted On

2018-03-15