Incidental Mutation 'R6294:Mki67'
ID508607
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R6294 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135704590 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 581 (M581T)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect probably benign
Transcript: ENSMUST00000033310
AA Change: M581T

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: M581T

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211437
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 H579L probably benign Het
Aldh2 G A 5: 121,572,816 Q8* probably null Het
Ankdd1a G T 9: 65,520,164 H10Q probably benign Het
Arpp21 A G 9: 112,127,452 F453L probably damaging Het
Birc6 C A 17: 74,689,257 D4461E probably benign Het
Cacna1b A T 2: 24,719,057 S411T possibly damaging Het
Camk2g A G 14: 20,764,949 I203T probably damaging Het
Cat A T 2: 103,460,295 C425S probably benign Het
Ccdc34 A G 2: 110,018,151 D95G probably benign Het
Clca4b T C 3: 144,925,185 S305G probably null Het
Cul7 T C 17: 46,663,148 I1453T probably benign Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 K561T probably benign Het
Erbin T C 13: 103,857,056 T359A probably benign Het
Far2 T A 6: 148,157,482 L222Q probably damaging Het
Fbxw17 A G 13: 50,423,803 E114G probably benign Het
Fryl A T 5: 73,191,759 probably benign Het
Ggn A G 7: 29,173,848 D666G possibly damaging Het
Hal G A 10: 93,514,143 probably null Het
Htt A G 5: 34,821,826 D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 S87L probably damaging Het
Klhl29 A T 12: 5,083,995 F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 Y7N unknown Het
Lama4 T A 10: 39,075,470 F1070L probably damaging Het
Map4 A G 9: 110,002,746 E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mtss1l T A 8: 110,727,328 N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 I475F probably damaging Het
Nat14 C T 7: 4,924,074 R82* probably null Het
Nckap1 T C 2: 80,541,514 N324S probably benign Het
Nemp1 C T 10: 127,694,522 T281M possibly damaging Het
Nrg3 A T 14: 38,397,239 H425Q probably benign Het
Olfr101 T A 17: 37,299,553 T290S probably benign Het
Olfr1318 A G 2: 112,156,019 I23V probably benign Het
Olfr1487 T C 19: 13,619,366 V25A probably benign Het
Olfr584 A T 7: 103,085,667 I45F probably benign Het
Olfr622 A G 7: 103,639,591 M183T probably damaging Het
Olfr95 T C 17: 37,211,626 T76A probably benign Het
Omd T A 13: 49,589,991 N172K probably damaging Het
Orc1 T C 4: 108,590,670 I38T probably benign Het
Oxct1 A G 15: 4,142,822 T457A possibly damaging Het
Pcdh17 A T 14: 84,477,668 K924N probably benign Het
Pkhd1l1 A T 15: 44,570,028 I3435F probably damaging Het
Psg20 C A 7: 18,682,679 V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 Y372* probably null Het
Rell1 G T 5: 63,939,705 probably benign Het
Rps14 A G 18: 60,776,961 K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 probably null Het
Slc14a1 T A 18: 78,110,058 probably null Het
Smad2 A T 18: 76,289,162 N215I probably benign Het
Smchd1 A T 17: 71,370,927 N1473K probably benign Het
Spag9 A G 11: 94,093,485 probably null Het
Stk31 A C 6: 49,417,344 R213S probably benign Het
Tmod4 A T 3: 95,128,306 Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 Y3F probably benign Het
Tom1l1 A C 11: 90,661,761 Y206* probably null Het
Tulp2 A G 7: 45,514,692 K36E probably damaging Het
Tulp4 C T 17: 6,201,819 R282C probably damaging Het
Unc5b A T 10: 60,778,331 N246K possibly damaging Het
Ush2a C G 1: 188,536,370 S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 F601L probably benign Het
Zc3h3 A T 15: 75,809,568 S555T possibly damaging Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
BB003:Mki67 UTSW 7 135697140 missense possibly damaging 0.91
BB013:Mki67 UTSW 7 135697140 missense possibly damaging 0.91
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
R7217:Mki67 UTSW 7 135704182 missense probably damaging 1.00
R7239:Mki67 UTSW 7 135700176 missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135699324 missense possibly damaging 0.90
R7313:Mki67 UTSW 7 135694671 missense probably benign 0.29
R7336:Mki67 UTSW 7 135713839 missense probably benign 0.03
R7422:Mki67 UTSW 7 135698370 missense probably damaging 1.00
R7451:Mki67 UTSW 7 135699351 missense probably benign 0.01
R7502:Mki67 UTSW 7 135700783 missense possibly damaging 0.53
R7513:Mki67 UTSW 7 135693223 missense probably benign
R7578:Mki67 UTSW 7 135700915 missense possibly damaging 0.68
R7619:Mki67 UTSW 7 135699377 missense probably benign 0.01
R7646:Mki67 UTSW 7 135696769 missense possibly damaging 0.63
R7659:Mki67 UTSW 7 135697426 missense probably damaging 1.00
R7691:Mki67 UTSW 7 135701992 missense not run
R7780:Mki67 UTSW 7 135713968 missense probably benign 0.02
R7796:Mki67 UTSW 7 135698194 missense probably damaging 1.00
R7904:Mki67 UTSW 7 135693087 missense possibly damaging 0.90
R7911:Mki67 UTSW 7 135704604 missense probably damaging 1.00
R7921:Mki67 UTSW 7 135695204 missense probably benign 0.01
R7926:Mki67 UTSW 7 135697140 missense possibly damaging 0.91
R7950:Mki67 UTSW 7 135699724 nonsense probably null
R8130:Mki67 UTSW 7 135697564 missense probably damaging 1.00
R8145:Mki67 UTSW 7 135694336 missense probably benign 0.07
R8196:Mki67 UTSW 7 135695508 missense probably damaging 1.00
R8220:Mki67 UTSW 7 135698121 missense probably benign 0.03
R8299:Mki67 UTSW 7 135704620 missense probably damaging 1.00
R8334:Mki67 UTSW 7 135696516 missense probably damaging 0.98
R8350:Mki67 UTSW 7 135698471 missense possibly damaging 0.82
R8358:Mki67 UTSW 7 135700126 missense possibly damaging 0.46
R8529:Mki67 UTSW 7 135713959 critical splice donor site probably null
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCGTCTGCTTTTGAGGGAC -3'
(R):5'- AAGAGTCTCCTGGGATAACGC -3'

Sequencing Primer
(F):5'- AGGGACATGTTTCGCAACTTTC -3'
(R):5'- TGGGATAACGCCACCGAG -3'
Posted On2018-03-15