Incidental Mutation 'R6294:Nrg3'
ID508632
Institutional Source Beutler Lab
Gene Symbol Nrg3
Ensembl Gene ENSMUSG00000041014
Gene Nameneuregulin 3
Synonymsska
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R6294 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location38368952-39473088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38397239 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 425 (H425Q)
Ref Sequence ENSEMBL: ENSMUSP00000134727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166968] [ENSMUST00000168810] [ENSMUST00000173780]
Predicted Effect probably benign
Transcript: ENSMUST00000166968
AA Change: H425Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136884
Gene: ENSMUSG00000041014
AA Change: H425Q

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
Pfam:Neuregulin 355 480 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168810
AA Change: H425Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129783
Gene: ENSMUSG00000041014
AA Change: H425Q

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173780
AA Change: H425Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134727
Gene: ENSMUSG00000041014
AA Change: H425Q

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neuregulin gene family. This gene family encodes ligands for the transmembrane tyrosine kinase receptors ERBB3 and ERBB4 - members of the epidermal growth factor receptor family. Ligand binding activates intracellular signaling cascades and the induction of cellular responses including proliferation, migration, differentiation, and survival or apoptosis. This gene encodes neuregulin 3 (NRG3). NRG3 has been shown to activate the tyrosine phosphorylation of its cognate receptor, ERBB4, and is thought to influence neuroblast proliferation, migration and differentiation by signalling through ERBB4. NRG3 also promotes mammary differentiation during embryogenesis. Linkage studies have implicated this gene as a susceptibility locus for schizophrenia and schizoaffective disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but their biological validity has not been verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mutations in this gene result in abnormal, genetic background specific, mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 H579L probably benign Het
Aldh2 G A 5: 121,572,816 Q8* probably null Het
Ankdd1a G T 9: 65,520,164 H10Q probably benign Het
Arpp21 A G 9: 112,127,452 F453L probably damaging Het
Birc6 C A 17: 74,689,257 D4461E probably benign Het
Cacna1b A T 2: 24,719,057 S411T possibly damaging Het
Camk2g A G 14: 20,764,949 I203T probably damaging Het
Cat A T 2: 103,460,295 C425S probably benign Het
Ccdc34 A G 2: 110,018,151 D95G probably benign Het
Clca4b T C 3: 144,925,185 S305G probably null Het
Cul7 T C 17: 46,663,148 I1453T probably benign Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 K561T probably benign Het
Erbin T C 13: 103,857,056 T359A probably benign Het
Far2 T A 6: 148,157,482 L222Q probably damaging Het
Fbxw17 A G 13: 50,423,803 E114G probably benign Het
Fryl A T 5: 73,191,759 probably benign Het
Ggn A G 7: 29,173,848 D666G possibly damaging Het
Hal G A 10: 93,514,143 probably null Het
Htt A G 5: 34,821,826 D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 S87L probably damaging Het
Klhl29 A T 12: 5,083,995 F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 Y7N unknown Het
Lama4 T A 10: 39,075,470 F1070L probably damaging Het
Map4 A G 9: 110,002,746 E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mki67 A G 7: 135,704,590 M581T probably benign Het
Mtss1l T A 8: 110,727,328 N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 I475F probably damaging Het
Nat14 C T 7: 4,924,074 R82* probably null Het
Nckap1 T C 2: 80,541,514 N324S probably benign Het
Nemp1 C T 10: 127,694,522 T281M possibly damaging Het
Olfr101 T A 17: 37,299,553 T290S probably benign Het
Olfr1318 A G 2: 112,156,019 I23V probably benign Het
Olfr1487 T C 19: 13,619,366 V25A probably benign Het
Olfr584 A T 7: 103,085,667 I45F probably benign Het
Olfr622 A G 7: 103,639,591 M183T probably damaging Het
Olfr95 T C 17: 37,211,626 T76A probably benign Het
Omd T A 13: 49,589,991 N172K probably damaging Het
Orc1 T C 4: 108,590,670 I38T probably benign Het
Oxct1 A G 15: 4,142,822 T457A possibly damaging Het
Pcdh17 A T 14: 84,477,668 K924N probably benign Het
Pkhd1l1 A T 15: 44,570,028 I3435F probably damaging Het
Psg20 C A 7: 18,682,679 V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 Y372* probably null Het
Rell1 G T 5: 63,939,705 probably benign Het
Rps14 A G 18: 60,776,961 K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 probably null Het
Slc14a1 T A 18: 78,110,058 probably null Het
Smad2 A T 18: 76,289,162 N215I probably benign Het
Smchd1 A T 17: 71,370,927 N1473K probably benign Het
Spag9 A G 11: 94,093,485 probably null Het
Stk31 A C 6: 49,417,344 R213S probably benign Het
Tmod4 A T 3: 95,128,306 Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 Y3F probably benign Het
Tom1l1 A C 11: 90,661,761 Y206* probably null Het
Tulp2 A G 7: 45,514,692 K36E probably damaging Het
Tulp4 C T 17: 6,201,819 R282C probably damaging Het
Unc5b A T 10: 60,778,331 N246K possibly damaging Het
Ush2a C G 1: 188,536,370 S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 F601L probably benign Het
Zc3h3 A T 15: 75,809,568 S555T possibly damaging Het
Other mutations in Nrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Nrg3 APN 14 38370801 missense probably damaging 0.99
IGL01994:Nrg3 APN 14 39012086 missense probably damaging 1.00
IGL02002:Nrg3 APN 14 38370767 nonsense probably null
IGL02247:Nrg3 APN 14 38371312 missense probably damaging 0.98
IGL02967:Nrg3 APN 14 38668299 splice site probably benign
R6803_Nrg3_459 UTSW 14 39012000 nonsense probably null
FR4304:Nrg3 UTSW 14 38397273 small insertion probably benign
FR4449:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4548:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4589:Nrg3 UTSW 14 38397266 small insertion probably benign
R0178:Nrg3 UTSW 14 38376456 missense probably damaging 1.00
R0825:Nrg3 UTSW 14 39472391 missense possibly damaging 0.67
R1545:Nrg3 UTSW 14 38407154 missense probably benign 0.03
R2009:Nrg3 UTSW 14 38370814 missense probably damaging 0.99
R2022:Nrg3 UTSW 14 38376352 missense probably damaging 0.98
R2264:Nrg3 UTSW 14 38381702 missense probably damaging 1.00
R2937:Nrg3 UTSW 14 38371008 missense possibly damaging 0.94
R2958:Nrg3 UTSW 14 39472712 missense unknown
R3085:Nrg3 UTSW 14 38370949 missense probably damaging 0.99
R3801:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R3803:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R4246:Nrg3 UTSW 14 39472241 missense possibly damaging 0.58
R5584:Nrg3 UTSW 14 39472697 small deletion probably benign
R5625:Nrg3 UTSW 14 38370993 missense probably damaging 0.99
R5870:Nrg3 UTSW 14 39472629 missense possibly damaging 0.95
R6007:Nrg3 UTSW 14 39472452 nonsense probably null
R6047:Nrg3 UTSW 14 38397352 critical splice acceptor site probably null
R6803:Nrg3 UTSW 14 39012000 nonsense probably null
R7023:Nrg3 UTSW 14 38376376 missense probably damaging 1.00
R7159:Nrg3 UTSW 14 38370735 nonsense probably null
R7194:Nrg3 UTSW 14 39472478 missense probably benign 0.17
R7297:Nrg3 UTSW 14 38370939 missense probably benign 0.10
R7413:Nrg3 UTSW 14 38370712 missense probably damaging 0.99
R7474:Nrg3 UTSW 14 39011999 missense probably damaging 0.98
R7684:Nrg3 UTSW 14 39472565 missense probably damaging 1.00
R7848:Nrg3 UTSW 14 38668283 missense probably damaging 1.00
R7931:Nrg3 UTSW 14 38668283 missense probably damaging 1.00
X0020:Nrg3 UTSW 14 38397241 missense probably benign 0.01
Z1176:Nrg3 UTSW 14 39472533 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTGTCAGCGACCAGTTATTG -3'
(R):5'- GCCAAGACCTAGCTTCAAACTTTTAAC -3'

Sequencing Primer
(F):5'- CTCAGATGTTCAAGTAATGGCCAGC -3'
(R):5'- ACCTAGCTTCAAACTTTTAACTGTAG -3'
Posted On2018-03-15